Introduction to DNA microarrays DTU - May 2008 - Hanne Jarmer.

Slides:

Advertisements

Similar presentations

Microarray Technique, Analysis, and Applications in Dermatology Jennifer Villaseñor-Park 1 and Alex G Ortega-Loayza 2 1 Department of Dermatology, University.

Advertisements

Application of available statistical tools Development of specific, more appropriate statistical tools for use with microarrays Functional annotation of.

Modeling sequence dependence of microarray probe signals Li Zhang Department of Biostatistics and Applied Mathematics MD Anderson Cancer Center.

What if we want to know what allele(s) of beta-globin an individual has?

Microarray Basics, and Planning a Microarray Experiment

Chapter Six Nucleic Acid Hybridization: Principles & Applications 1.Preparation of nucleic acid probes: - DNA: from cell-based cloning or by PCR. Probe.

Microarray Simultaneously determining the abundance of multiple(100s-10,000s) transcripts.

Statistics for Microarrays

Introduction to DNA Microarray Technology Steen Knudsen, April 2005.

Getting the numbers comparable

DNA microarray and array data analysis

Gene expression analysis summary Where are we now?

DNA Microarray Bioinformatics - #27611 Program Normalization exercise (from last week) Dimension reduction theory (PCA/Clustering) Dimension reduction.

DNA Microarray Bioinformatics - #27612 Normalization and Statistical Analysis.

DNA Microarray: A Recombinant DNA Method. Basic Steps to Microarray: Obtain cells with genes that are needed for analysis. Isolate the mRNA using extraction.

Class 6 DNA Arrays BIOMEMS, Fall Content u Polymerase Chain Reaction or PCR u DNA Detection Process u DNA Micro Arrays u Electronic DNA Arrays u.

DNA Microarrays for Statisticians. cDNA Microarray Applications Revolutionized gene expression studies Diagnose cancer Expression profile of tumor progression.

Sample preparation 1. Design experiment Question? Replicates? Test? 2. Perform experiment 4. Label RNA Amplification? Direct or indirect? Label? wild.

DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative.

Central Dogma 2 Transcription mRNA Information stored In Gene (DNA) Translation Protein Transcription Reverse Transcription SELF-REPAIRING ARABIDOPSIS,

Microarray Technology Types Normalization Microarray Technology Microarray: –New Technology (first paper: 1995) Allows study of thousands of genes at.

Data analytical issues with high-density oligonucleotide arrays A model for gene expression analysis and data quality assessment.

5 µm Millions of copies of a specific oligonucleotide probe >5 760,000 different complementary probes ~ targets Single stranded, labeled ‘target’

Introduce to Microarray

Next Generation Microarray Technology: Overview of Febit’s Geniom One ® H. Bjørn Nielsen Center for Biological Sequence analysis Technical University of.

Gene Expression BMI 731 Winter 2005 Catalin Barbacioru Department of Biomedical Informatics Ohio State University.

Introduction to DNA microarrays DTU - January Hanne Jarmer.

Scanning and image analysis Scanning -Dyes -Confocal scanner -CCD scanner Image File Formats Image analysis -Locating the spots -Segmentation -Evaluating.

Analysis of GO annotation at cluster level by H. Bjørn Nielsen Slides from Agnieszka S. Juncker.

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

GeneChips and Microarray Expression Data

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

and analysis of gene transcription

with an emphasis on DNA microarrays

Lecture 189Functional Genomics Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Microarrays, RNAseq And Functional Genomics CPSC265 Matt Hudson.

Affymetrix vs. glass slide based arrays

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

Data Type 1: Microarrays

Microarray - Leukemia vs. normal GeneChip System.

Scenario 6 Distinguishing different types of leukemia to target treatment.

Introduction to DNA microarray technologies Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor short course Summer 2002.

What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale.

Genomics I: The Transcriptome

GeneChip® Probe Arrays

Topic intro slides More complete coverage of components involved in gene expression More information on expression technologies -what would the ideal chip.

Analysis of GO annotation at cluster level by Agnieszka S. Juncker.

MICROARRAY TECHNOLOGY

Introduction to Microarrays.

DTU - January Hanne Jarmer

Whole Genome Approaches to Cancer 1. What other tumor is a given rare tumor most like? 2. Is tumor X likely to respond to drug Y?

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Microarray Technology. Introduction Introduction –Microarrays are extremely powerful ways to analyze gene expression. –Using a microarray, it is possible.

Statistical Analysis of Microarray Data By H. Bjørn Nielsen.

Microarray hybridization Usually comparative – Ratio between two samples Examples – Tumor vs. normal tissue – Drug treatment vs. no treatment – Embryo.

Introduction to Microarrays. The Central Dogma.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Microarrays and Other High-Throughput Methods BMI/CS 576 Colin Dewey Fall 2010.

DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.

Transcriptome What is it - genome wide transcript abundance How do you obtain it - Arrays + MPSS What do you do with it when you have it - ?

Introduction to Oligonucleotide Microarray Technology

Microarray: An Introduction

MICROARRAY. Microarray  A multiplex lab-on-a-chip  A 2D array on a solid substrate (Usually a glass slide or silicon thin-film cell) that assays large.

The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.

Microarray Technology and Applications

Introduction to Microarrays.

Getting the numbers comparable

Presentation transcript:

Introduction to DNA microarrays DTU - May Hanne Jarmer

Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

How? gene specific DNA probes labeled target gene mRNA

Microarrays - The Technologies Stanford-type Microarrays High-density

Stanford-type Microarrays

Coating glass slides Deposition of probes Post-processing Hybridization

Spotting - Mechanical deposition of probes

16-pin microarrayer

Microarrayer

mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE CONTROL Stanford microarrays

Affymetrix GeneChip ® oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data K features to play with

Photolithography Mask #1 in situ synthesis Spacers bound to surface with photolabile protection groups

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #2

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #2

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

Sample Preparation - Eberwine RNA T7 dsDNA T7 pol SAMPLE ssDNA + Reverse Transcriptase + RNase H + Polymerase clean up dsDNA + Biotin-labeled nucleotides aRNA 42  C 2 h 16  C 2 h 37  C 6 h 70  C 10 min

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG

Detection of Biotin (Affymetrix) biotinylated anti-anti IgG

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) biotinylated anti-anti IgG

The Affymetrix GeneChip ® A gene is represented like this: - Perfect Match (PM) - MisMatch (MM) PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt) Service: -labelling -scanning -image analysis

Photolithography - Micromirrors

Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites,...

Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical Analysis Expression Index Calculation Advanced Data Analysis ClusteringPCAClassification Promoter Analysis Meta analysisRegulatory Network Comparable Gene Expression Data Normalization Image analysis The DNA Array Analysis Pipeline