Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Slides:

Advertisements

Similar presentations

Supplementary table 1: Primers used for PCR amplification Primer nameSequence 5`-3`Accession Number ChiFACCAAGCTACTCGCAAGAGGCD ChiRCGGAAGCGCAGTAAGATGA.

Advertisements

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Figure S1. Genomic PCR of in vitro potato plants transformed with StPTB1 prom (top) and StPTB6 prom (bottom) constructs using nptII-specific primers. Thirty.

By by Enkhchimeg Vanjildorj Supervisor Prof. Lee, Hyo-Yeon College of Applied Life Sciences, Cheju National University, Jeju , Korea College of.

(a) (b) (c) (d) (e) (f) (g) Figure S1.. Figure S1. Comparison of OsPCR1-6 and GW2 transcript levels in the grains of developing gw2 and wild-type isogenic.

Differential Accumulation Pattern of Met-rich  -zein in Medicago sativa and Medicago truncatula Serina Padilla Dr. Champa Sengupta-Gopalan, Mentor Department.

Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.

Soybean Transformation and Regeneration Using “Half-Seed” Explants Margie M. Paz and Kan Wang Department of Agronomy, Iowa State University, Ames, IA ,

Lim et al, Supplemental Figure S1. OsRING-H2 type : 5 OsRING-HC type : 1 OsRING-v type : 1 OsRING-H2 type : 9 OsRING-HC type : 8 OsRING-v type : 2 OsRING-H2.

Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

LOGO A novel WRKY transcriptional factor from Thlaspi caerulescens negatively regulates the osmotic stress tolerance of transgenic tobacco Plant Cell Rep.

Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Workpackage 2: Breeding Systems

Xba I kbp Sac I Hind III Fig. S1 Southern blot analysis using genomic DNA from Nona Bokra plants. Five µg of Nona Bokra genomic DNA was.

Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E.

Figure S1 (Chen) (a) 1xABRC321:GUS 1xABRC321 2xABRC321:GUS 2xABRC321 3xABRC321:GUS 3xABRC321 GUS 0xABRC321:GUS Amy64 mini PHVA22 In1-Ex2-In2 HVA22 3’ -60.

Gene Insertion and Expression of a MybA1 Transcription Factor in Nicotiana tabacum (Tobacco) Paige Jernigan.

Supplemental Figure 1. The cell death phenotype of fhy3 far1 double mutants. A. The cell death phenotype of fhy3-4 far1-2 mutant plants under LD conditions.

Hannah Jernigan Sheridan College

Volume 5, Issue 2, Pages (March 2012)

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang Molecular Plant

Hannah Jernigan University of Wyoming

Table A. Sequences used in making CsKASII RNAi constructs

(A) (B) Supplementary Fig. 1 Sequence alignment and Phylogenetic analysis of DJ-1 homologs. (A). Multiple sequence alignment of DJ1 homologs from A.

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

Fig. 1 The central rosette leaves of Arabidopsis exhibited a greater degree of freezing tolerance than did peripheral rosette leaves. Eighteen-day-old.

Supplemental Figure 1 A) B) C)

Volume 7, Issue 2, Pages (February 2014)

by Jian-Min Wang, Hong Zheng, Mila Blaivas, and Kotoku Kurachi

Volume 69, Issue 6, Pages (March 2006)

Characterization of transgenic mice.

Volume 5, Issue 2, Pages (March 2012)

Silencing in Yeast rDNA Chromatin

TsNAC1 regulated the growth of T. halophila.

Volume 2, Issue 1, Pages (January 2009)

Volume 7, Issue 5, Pages (May 2014)

Volume 4, Issue 6, Pages (November 2011)

Luo Chongyuan , Durgin Brittany G. , Watanabe Naohide , Lam Eric

Kim Min Jung , Ciani Silvano , Schachtman Daniel P. Molecular Plant

A Truncated Arabidopsis NUCLEOSOME ASSEMBLY PROTEIN 1, AtNAP1;3T, Alters Plant Growth Responses to Abscisic Acid and Salt in the Atnap1;3-2 Mutant Liu.

Liyuan Chen, Anne Bernhardt, JooHyun Lee, Hanjo Hellmann

Volume 8, Issue 5, Pages (May 2015)

A DTX/MATE-Type Transporter Facilitates Abscisic Acid Efflux and Modulates ABA Sensitivity and Drought Tolerance in Arabidopsis Haiwen Zhang, Huifen.

The Arabidopsis Transcription Factor AtTCP15 Regulates Endoreduplication by Modulating Expression of Key Cell-cycle Genes Li Zi-Yu , Li Bin , Dong Ai-Wu.

Arabidopsis MSBP1 Is Activated by HY5 and HYH and Is Involved in Photomorphogenesis and Brassinosteroid Sensitivity Regulation Shi Qiu-Ming , Yang Xi.

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

Volume 4, Issue 4, Pages (July 2011)

Xiang Han, Hao Yu, Rongrong Yuan, Yan Yang, Fengying An, Genji Qin

Bhola Shankar Pradhan, Subeer S. Majumdar

Volume 7, Issue 12, Pages (December 2014)

Volume 4, Issue 6, Pages (December 2001)

Figure S1. Schematic representation of the RieskeFeS over-expression vector pGWRi used to transform Arabidopsis (Col-0). cDNA are under transcriptional.

Cui-Cui Zhang, Wen-Ya Yuan, Qi-Fa Zhang Molecular Plant

Feng Xu, Qiongyi Zhang, Kangling Zhang, Wei Xie, Michael Grunstein

1O2-Mediated and EXECUTER-Dependent Retrograde Plastid-to-Nucleus Signaling in Norflurazon-Treated Seedlings of Arabidopsis thaliana Chanhong Kim, Klaus.

Volume 25, Issue 8, Pages (April 2015)

Volume 2, Issue 1, Pages (January 2009)

Volume 5, Issue 5, Pages (September 2012)

Volume 2, Issue 1, Pages (January 2009)

Wang Long , Mai Yan-Xia , Zhang Yan-Chun , Luo Qian , Yang Hong-Quan

Volume 2, Issue 4, Pages (July 2009)

Genome-Edited Triple-Recessive Mutation Alters Seed Dormancy in Wheat

Characterization of GmSIN1.

Presentation transcript:

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal name: Transgenic Research Authors: Vibha G. Checker, Anju K. Chhibbar and Paramjit Khurana Corresponding Authors: Paramjit Khurana Department of Plant Molecular Biology, University of Delhi South Campus, Dhaula Kuan, New Delhi , India. Supplementary data 2 Table 1 and Fig. S1 to S7

Line Abbreviation Average Leaf Area (cm 2 ) Internodal Length (cm) Control (NT)NT44.3 ± ± 0.2 actin1:Hva1ST37.0 ± ± 0.6 rd29A:Hva1VR153.3 ± ± 1.2 rd29A:Hva1VR ± ± 0.5 rd29A:Hva1VR ± ± 0.3 rd29A:Hva1VR ± ± 0.4 rd29A:Hva1VR ± ± 0.0 rd29A:Hva1VR ± ± 0.2 Supplementary data 2 Table 1: Morphological features of transgenic and non-transgenic lines

a b c DROUGHT STRESSSALT STRESS a b c Supplementary data 2, Fig. S1 Physiological characterization of actin1:Hva1 transgenic lines under drought (2% PEG) and salinity stress (400 mM NaCl). Proline content (a), Membrane injury (b), and Photosynthetic yield (Fv/Fm) (c) were measured at indicated time points. (K2 = Non- transgenic line, ST = actin1:Hva1 transgenic lines) Values are significant at P ≤ 0.05

(b)(b) (c)(c) ( d ) (g) (f)(f) (e)(e) (h)(h) NT ST VR9.1 (a)(a) Right border (25bp) BamHI Sac I pBI121:rd29a:Hva1 Nos-pro (302 bp) NPT II (795bp) Nos-ter (253 bp) rd29A-Pro (686bp) Hva 1 (642bp) Nos-ter (253 bp) Left Border (26 bp) HindIIII (g)(g) Supplementary data 2, Fig. S2 Transformation and regeneration of mulberry (Morus indica) cv. K-2 via Agrobacterium tumefaciens (pBI121:rd29A:Hva1). (a) Vector map of pBI121:rd29a:Hva1. (b) Non-transformed hypocotyl, cotyledon and calli respectively. (c) Transformed explants after transfer to selection medium. (d) Regenerating explants on shoot elongation medium. (e) Shoot explants on root inducing medium. (f) Regenerants established in earthen pots. (g) Morphology of some transgenic plants. (h) Appearance of non-transgenic (NT), ST (actin1:Hva1) and VR9.1 (rd29A:Hva1) plants

Ladder Hva 1 Positive 1000 bp 500 bp 250 bp a Transgenic plants Negative VR1 VR2 VR4.2 VR5.5 VR6.2 VR7.1 VR8.1VR9.1 VR11.3 VR12.1 VR11.3 Ladder Transgenic plants npt II 1000 bp 500 bp b VR1 VR4 VR5.5VR6.2 VR7.1 VR8.1 VR9.1 Positive Negative Supplementary data 2, Fig. S3 PCR analysis of genomic DNA samples of putative transgenic plants of M. indica cv. K2 using specific primers of Hva1 (a) and nptII (b)

VR 11.3 VR 9.1 VR1 VR2 VR 6.2 VR 5.3 NT Digested 23.4kb Hva 1 500bp NT Undigested Supplementary data 2, Fig. S4 Molecular confirmation of rd29A:Hva1 overexpressing transgenic mulberry plants (VR) and non-transgenic control plants (NT). Southern hybridization of genomic DNA samples of transgenic plants of mulberry was carried out with Hva1 gene as probe. Lane 1 and 2: NT (Non-transgenic/negative control), lane 3 to 8: BamHI and SacI digested samples of genomic DNA of transformed plantlets

ab cd Supplementary data 2, Fig. S5 Comparison of non-transgenic (NT), actin1:Hva1 (ST) and rd29A:Hva1 (VR) transgenic mulberry plants under control conditions. Proline content (a), percent membrane injury (b), photosynthetic yield (Fv/Fm) (c), and relative water content (RWC) (d) were measured to evaluate metabolic status of plants. Leaf tissues harvested on 0 day of the experiment were used for various analyses. Results are average of three experiments and three independent plants were taken for each experiment. Error bars represent standard deviation. Values are significant at P ≤ 0.05

STNT VR1 VR6.2 VR7.1VR8.1 VR9.1VR11.3 NT VR1 VR9.1 VR11.3 ST Supplementary data 2, Fig. S6 Western blot analysis to confirm expression of barley HVA1 in transgenic mulberry plants leaf proteins under field conditions Supplementary data 2, Fig. S7 In situ detection of reactive oxygen species (ROS) by nitroblue tetrazolium (NBT) staining of non-transgenic (NT), actin1:Hva1 (ST) and rd29A:Hva1 (VR) transgenic mulberry leaves. Blue color indicates the characteristic staining pattern of ROS