Lee H. Harrison, MD Associate Professor

Slides:



Advertisements
Similar presentations
Restriction Enzymes. Restriction Endonucleases Also called restriction enzymes 1962: “molecular scissors” discovered in in bacteria E. coli bacteria have.
Advertisements

UNIT 2 MANIPULATION OF DNA AND GENE ISOLATION LECTURES: 9. DNA Cloning and Library Construction 10. Isolating Genes.
Overview of Molecular Epidemiological Methods for the Subtyping and Comparison of Viruses Derek Wong
Restriction Enzymes.
Detection and Measurement of Genetic Variation
Restriction Enzymes Aims: Must be able to recall the basic functions of restriction enzymes. Should be able to outline how specific restriction enzymes.
6.1 Biotechnological Tools and Techniques Recombinant DNA & Gel electrophoresis.
Genetic Engineering. Vocabulary Gene – sequence of DNA that codes for a trait (protein). Genome – an organism’s complete genetic information. Transgenic.
Typing methods for bacteria
Restriction Enzymes.
MOLECULAR TYPING OF MICROORGANISMS…... INTRODUCTION  DEFINITION: Molecular typing procedures can be broadly defined as methods used to differentiate.
& Gel Plasmid Electrophoresis Mapping.
©2000 Timothy G. Standish Restriction Enzyme Digestion Timothy G. Standish, Ph. D.
Section 20.3 – DNA and Biotechnology. DNA and Biotechnology  Carpenters require tools such as hammers, screwdrivers, and saws, and surgeons require scalpels,
Chapter 20: Biotechnology. Essential Knowledge u 3.a.1 – DNA, and in some cases RNA, is the primary source of heritable information (20.1 & 20.2)
Genetic Engineering DNA technology. Palindromes  mom  wow  race car  straw warts  never odd or even  stella won no wallets  was it a car or a cat.
(RFLP Electrophoresis)
Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:
Biotechnology SB2.f – Examine the use of DNA technology in forensics, medicine and agriculture.
{ Genetic Engineering Application of molecular genetics (understanding of DNA) for practical purposes.
1 Genetics Faculty of Agriculture Instructor: Dr. Jihad Abdallah Topic 13:Recombinant DNA Technology.
DNA Technology Chapter 20.
Restriction Enzymes Enzymes that CUT
DNA Fingerprinting. Use of DNA to Determine Identity DNA controls production of proteins DNA controls production of proteins Results in phenotype (eye.
DNA Technology and Genomics Chapter 20 A. P. Biology Mr. Knowles Liberty Senior High School.
Restriction Enzymes. Restriction Endonucleases Also called restriction enzymes “molecular scissors” discovered in in bacteria Restriction enzymes is an.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.
Molecular Genetics Lab Review. Bacterial Transformation Genetic transformation—host organism takes in and expresses foreign DNA Genetic engineering—manipulation.
Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.
DNA Technology. Overview DNA technology makes it possible to clone genes for basic research and commercial applications DNA technology is a powerful set.
Chapter 9 Genetic Engineering. Genetic engineering: moving a gene from one organism to another – Making insulin and other hormones – Improving food –
Gene transfer.
PHARMACOBIOTECHNOLOGY.  Recombinant DNA (rDNA) is constructed outside the living cell using enzymes called “restriction enzymes” to cut DNA at specific.
(RFLP Electrophoresis)
Chapter 20 DNA Technology & Genomics. Genetic engineering Manipulation of genetic material for practical purposes has begun industrial revolution in biotechnology.
DNA Fingerprinting Project Lead the Way Human Body Systems.
Restriction Enzymes Gabriela Perales 1. Restriction Enzymes  Restriction enzymes, also called restriction endonucleases, are molecules that cut double.
Restriction Enzymes. What Are Restriction Enzymes? Endonucleases produced by prokaryote organisms that are capable of cutting DNA at specific sequences.
Restriction Enzyme Digest October 8, Restriction Enzymes.
Restriction Enzymes Biotechnology Fall 2013.
Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.
Bacterial cloning Especially of PCR product DNA. PCR recap.
Relationship between Genotype and Phenotype
DO NOW What is a genome? In what year was the Human Genome Sequence completed? How different is your genome from Mrs. Schwichtenberg? (Give a percent)
What can you do with DNA? Chapter 8. Success Criteria At the end of class today, you will be able to: Explain what a restriction enzyme is and what role.
KEY CONCEPT DNA sequences of organisms can be changed.
Biotechnology I. POINT > Define what restriction enzymes are POINT > Describe how restriction enzymes cut DNA POINT > Show how restriction enzymes facilitate.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Using Restriction Enzymes to Make Recombinant DNA Bacteria and Archaea have evolved.
Restriction Enzymes. Discovery  In 1962, Werner Arber, a Swiss biochemist, provided the first evidence for the existence of "molecular scissors" that.
Forensic DNA Fingerprinting: Using Restriction Enzymes.
Gene Expression PowerPoint presentation text copied directly from NJCTL with corrections made as needed. Graphics may have been substituted with a similar.
TYPING METHODS: It is sometimes important to analyse multiple isolates within a given species to determine whether they represent a single strain or multiple.
2 Chapter 9 Biotechnology & Recombinant DNA 3 Recombinant Technologies Terminology Recombinant DNA - artificially manipulated DNA Genetic Engineering.
GENETIC TECHNOLOGY Genetically engineered bollworm.
Figure 20.0 DNA sequencers DNA Technology.
Tools for manipulating DNA
DNA Technology Now it gets real…..
5. Genetic Engineering Techniques
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Restriction Enzyme Analysis of Lambda DNA
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Genetically Modified Organisms
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Gene transfer © 2016 Paul Billiet ODWS.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Genetic Egineering Isolation Cutting Ligation and Insertion
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Comparison of macrorestriction analysis of genomic DNA by pulsed-field gel electrophoresis and ribotyping with conventional methods for differentiation.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Presentation transcript:

Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks Lee H. Harrison, MD Associate Professor Departments of Epidemiology and Medicine University of Pittsburgh

What is molecular epidemiology in infectious diseases? Purpose: Determine modes of transmission and source of infection Principal: Exploit pheno-/genotypic differences between strains Practice: Molecular subtyping of bacterial/fungal/viral/parasitic isolates

Molecular Epidemiology in Infectious Diseases: Why molecular methods? Previously used methods: antimicrobial susceptibility patterns serologic/biochemical typing Examples: 95% of invasive H. influenzae were serotype b L. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b)

Molecular Epidemiology in Infectious Diseases: Basic Types of Methods Genotypic methods DNA based Heritable and stable Not affected by isolation/culture conditions Phenotypic methods Rely on expressed characteristics Affected by isolation/culture/test conditions

Molecular Epidemiology in Infectious Diseases: Common Methods Analysis of chromosomal DNA Restriction endonuclease analysis (REA) Pulse field gel electrophoresis (PFGE) Restriction fragment length polymorphism (RFLP) rDNA gene restriction patterns (ribotyping) Nucleic acid sequencing Nucleic acid hybridization of entire genome

Molecular Epidemiology in Infectious Diseases: Common Methods Analysis of plasmid DNA Plasmid size Restriction digests Protein analysis Outer membrane protein (OMP) analysis Multilocus enzyme typing (MLE)

Click for larger picture

Recognition Sequences of Selected Restriction Endonucleases EcoR I Hind III Hha II Source Escherichia coli RY13 H. influenzae Rd H. parainfluenze Sequence GAATTC CTTAAG AAGCTT TTCGAA CCGG GGCC

DNA Cutting by HIND III: Staggered Cuts Leaving “Sticky” Ends TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC TTCGAATA AAGCTTATTCG AGCTTCCCTGAG AAGGGACTC +

General principals of molecular subtyping using restriction endonucleases Bacterial chromosomal DNA . C . C . C . C Electrophoresis . C . C . . . C C C C . = Restriction endonuclease (“molecular scissors”) = DNA sequence recognized by restriction endonuclease

Molecular Epidemiology in Infectious Diseases: Common Methods Nucleic acid detection Plasmid size Restriction digests Phage typing

Pulsed-Field Gel Electrophoresis

Genetic relatedness (dendrogram) analysis

Molecular Epidemiology in Infectious Diseases: Interpretation of Data Heterogeneity within species Must have knowledge of frequency distribution of subtypes Utility of individual method is species specific

Molecular Epidemiology in Infectious Diseases: Requirements Method must work with vast majority of isolates Reproducibility Discrimination power Ease of method Ease of interpretation

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.