Standardization of Pedigree Collection

Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor 2

Genetic Approaches to Gene Identification In Alzheimer’s Disease

Identifying genes for complex disease Association   Test candidate gene   Collect sample of affected and control subjects   Compare frequency of a genetic polymorphism in 2 samples Linkage  Test entire genome  Collect families with multiple affected members AffectedControl

Linkage vs. Association   Linkage   Measures the segregation of alleles and a phenotype within a family   Detected over large physical distances   Association   Measures preferential segregation of a particular allele with a phenotype across families   Detected over shorter distances

Meiosis and Linkage   Gamete formation   Meiosis I: Homologous chromosomes pair   Crossing over occurs   Genes that are physically close together are more likely to be coinherited   Genes that are physically far apart on the chromosome are less likely to be coinherited

Linkage Approach   Seeks to identify, IN FAMILIES, chromosomal regions that are consistently transmitted to affected individuals.   Identify these regions using ‘markers’   Find a marker which is ‘linked’ to the disease

Linkage: Autosomal Dominant

Traditional Linkage Approach   Successful in the identification of genes for Alzheimer’s disease   Amyloid precursor protein (APP)   Presenilin I (PS1)   Presenilin II (PS2)

Further Genetic Studies   Clearly, most families with Alzheimer’s disease do not have a clear pattern of Mendelian inheritance   Already, one susceptibility gene has been identified whose alleles can either increase or decrease the risk of AD   There are certainly other genes which are to be identified

How to tackle finding these other genes?

Genetics of Alzheimer’s Disease Alzheimer’s Disease Gene 1 Gene 2 Environmental Factor 1 Environmental Factor 2

Linkage in Complex Disease   Identify families with multiple affected members   Increases the likelihood that genes are important in disease susceptibility in that family   Pattern of inheritance less certain   Collect family members to follow segregation of disease and marker alleles

Identity By Descent (IBD) Allele 1 AGCTCACACACACACACACACAATCG Allele 2 AGCTCACACACACACACAATCGTCGA Allele 3 AGCTCACACACACAATCGTCGACCGC Allele 4 AGCTCACACACAATCGTCGACCGCGG

Linkage Analysis   Employ nonparametric linkage methods   Identify chromosomal regions that are preferentially transmitted within a family to the affected individuals.   Method is not based on recombination but on IBD marker allele sharing

Analysis of Affected Relatives   Look for chromosomal regions shared in common by affected relatives in the same family.   Presume that affected individuals in the same family will have some similar susceptibility genes.   Look at patterns across families to determine if the same chromosomal region is being shared.

Genome Screen Approach   Evaluate the entire genome   Analyze markers located at regular intervals throughout the genome   Identify regions that are consistently shared by affected relatives Markers

Association Studies   Once a chromosomal region has been identified which is linked to AD, additional studies are necessary to identify the causative gene   Association studies typically test for linkage disequilibrium rather than linkage.   Linkage disequilibrium extends over shorter distances.   Often employ SNPs.

Association Studies   Studies of linkage disequilibrium can study:   Transmission of alleles throughout a family consisting of affected and unaffected individuals.   Compare allele frequencies between affected and unaffected individuals.   Many new methods are being developed to more effectively test for linkage disequilibrium.

AD Genetics Initiative Goals   Identification of genes contributing to Mendelian forms of AD are very important.   Provide insight into important pathways   Provide potential candidate genes to examine in non-Mendelian forms of disease   This study seeks to identify the genes contributing to non-Mendelian forms of AD.

Design of the AD Genetics Initiative

Appropriate Families for Study   At least 2 living siblings with LOAD (onset > 60 years)   At least 1 other living related family member who :   Has AD (onset > 50 years) Or   Is unaffected (> 60 years)

Appropriate Families for Study   Who should be collected in this family? Why?   If parents in generation I are alive, they should be collected.   Collection of the parents will allow allele sharing to be determined more definitely in studies of the siblings in generation II.   More definitive allele sharing produces more definite linkage results -> more power to find genes for AD I II

Appropriate Families for Study   Who should be collected in this family? Why?   Collect all siblings in generation II (AD and non-AD)   This is particularly important if the parents in generation I are deceased   Study allele sharing in generation II.   Studies can compare allele sharing among the AD siblings and the discordant siblings   Can evaluate linkage disequilibrium. I II

Deceased Family Members   Testing markers in the parents and offspring of a deceased person makes it possible to estimate what the individual must have inherited

Reconstruction   Estimating a missing person’s likely genotype is termed ‘reconstruction’.   This is the principal being employed in the identification of specimens in many forensic cases.

Power to Reconstruct   The power to reconstruct a missing genotype is dependent on how many closely related family members can be sampled.   The important people to sample are the offspring of a deceased, affected individual.

Appropriate Families for Study   Who should be collected in this family? Why?   Offspring of the individuals in generation II can be important for genetic studies.   Do any individuals in generation III have symptoms of memory loss or AD? If so, collect them.   Are any of the individuals in generation III over the age of 60 years? Longitudinal follow-up of these individuals may identify new cases of AD. I II

Appropriate Families for Study   Who should be collected in this family? Why?   If any offspring in generation III are collected, it is important to also collect both their parents, when possible.   The individual in blue is important when determining which alleles the offspring in generation III have inherited from her affected father. I II III

Appropriate Families for Study   Who should be collected in this family? Why?   Did anyone in the family have an autopsy and is tissue still available?   Collect information about these individuals and consider obtaining these materials, if possible. I II

Who to collect?   A commonly asked question is who should I collect a blood sample from in a genetic study?   The answer is all genetically informative individuals!

Who is genetically informative   Genetic analysis seeks to study the transmission of marker alleles throughout the family.   When we can determine the inheritance of all marker alleles unambiguously, we have the greatest power to find genes for disease!   Unaffected individuals may be very important for collection.

Who is genetically informative   Collect affected individuals   Collect as many individuals with a as are willing to participate

Who is genetically informative Insert pedigree with affected siblings + aunt go through who to collect summarize at bottom of slide   Collect affected individuals   Collect as many individuals with a as are willing to participate

Which are the best families?   Families with the largest number of affected individuals.   Strong family history suggests more genetic.   Unaffected individuals in families with many affected individuals are also very important, particularly if they are examined clinically.

Who is genetically informative   Collect all affected individuals   Collect any living connecting relatives   Collect any unaffected siblings

Which are the best families?   Cooperative Families   Families eager to participate in research will typically complete the study faster.   Provide annual follow-up information more easily.   Assist in research if additional information/samples are needed.   Important to remain in contact with families and provide them with information about the study

Who to Collect   Collect the parents in generation I, if available   Collect all siblings in generation II (affected and unaffected)   Collect any individuals in generation III with memory loss   Collect any individuals in generation III > 60 years   Query for any other affected cousins, half siblings, aunts, uncles?? I II III

When in Doubt??  Contact Susan LaRusse who will help sites identify the critical individuals in their pedigrees.