National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok 05-06 th Aug 2008.

Slides:



Advertisements
Similar presentations
ASBESTOS A GLOBAL KILLER Women in Europe for a Common Future - WECF Women in Europe for a Common Future - WECF
Advertisements

ASBESTOS IN THE EECCA: KEY PROBLEMS The survey was developed by Eco-Accord, MAMA-86, Greenwomen Women in Europe for the Common Future Dutch Ministry of.
HEALING THE CRISIS The urgent need to improve public health in SEE Ana Stavljenic-Rukavina Zagreb University School of Medicine and OSI NY:Sub-board for.
Kidane Asmerom and Teh wei-Hu
Public Health Perspective on Radon Control in Ireland Dr. Ina Kelly Specialist Registrar in Public Health Medicine Health Service Executive Department.
Consumer Right Justice : A Case Study of Asbestos
Breast Cancer Policies: A Systems Approach Palak Raval-Nelson, MPH, PhD (Candidate)
The Role of Research in Tobacco Control
Workers’ compensation claims paid in Australia Terry Slevin, Chair, Occupational and Environmental Cancer Committee Cancer Council Australia.
Cancer Prevention Dr Brenda Wilson Department of Epidemiology & Community Medicine.
Introduction to Occupational Safety and Health An Approach to addressing injuries and illnesses at work.
HEAPHY 1 & 2 DIAGNOSTIC James HAYES Fri 30 th Aug 2013 Session 2 / Talk 4 11:33 – 12:00 ABSTRACT To estimate population attributable risks for modifiable.
Curtin University is a trademark of Curtin University of Technology CRICOS Provider Code 00301J Renee N Carey 1 and the AWES-Cancer team 1-4 The lifetime.
National Strategic Plan for Asbestos Management and Awareness Peter Tighe Chief Executive Officer, Asbestos Safety and Eradication Agency.
Asbestos and Health WHO recommendations on elimination of asbestos-related diseases Dr Ivan D. Ivanov Public Health and Environment World Health Organization.
Occupational exposure and Cancer : perspectives from the trade unions Tony Musu European Trade Union Institute (ETUI) HEAL workshop Cancer Prevention &
Global Immunization Performance Update through 2011.
Child deaths: Causes and epidemiological dimensions Robert E. Black, M.D., M.P.H. Johns Hopkins Bloomberg School of Public Health.
Non-communicable diseases David Redfern
Economics of Global Tobacco Control Kenneth E. Warner University of Michigan School of Public Health Presented to the Interagency Committee on Smoking.
Medical aspects of asbestos exposure Sjaak Burgers respiratory physician Netherlands Cancer Institute, Amsterdam
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCC TGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
Chrysotile Asbestos and Disease Dr Sophia Kisting Occupational and Environmental Health Research Unit, University of Cape Town, South Africa NUM Parliamentary.
HEALTHY CARIBBEAN 2008 Revolutionizing the Prevention and Management of Lung Disease Dr. Timothy Roach FRCP FACP Head, Respiratory Unit Queen Elizabeth.
Current Situation of Asbestos in Thailand Dr. Somkiat Siriruttanapruk Bureau of Occupational and Environmental Diseases, Ministry of Public Health, Thailand.
Smoking cessation aided by low-toxicity smokeless tobacco can save many lives Lars M. Ramström Institute for Tobacco Studies Täby, Sweden UKNSCC 2014 Thursday.
NHPA’s. What are they? National Health Priority Areas (NHPAs) are diseases and conditions chosen for focused attention at a national level because of.
Asbestos Report Australia Phillip Hazelton –Mekong Regional Representative Union Aid Abroad – APHEDA Margot Hoyte OHS ACTU.
Lung Cancer Molecular Pathology of Cancer Boot Camp January 4, 2012 Jennifer Rider, ScD.
Decent Work for All ASIAN DECENT WORK DECADE
Take a Stand Murphree, Bella Period 1B Abrams March 29, 2012.
Asbestos: New Strategies & Joint Working European Hazards Network Conference Riga, Latvia; 30 th September 2006 Asbestos: New Strategies & Joint Working.
Exclusive breastfeeding for first six months :Core Issues Planning workshop IYCF, Vietnam September,2003. Hanoi. Dr. Arun Gupta MD FIAP Regional.
1 1 Bose: SEAR Highlights and Priorities Global Measles & Rubella Management Meeting Geneva, March 2011 Accelerated Measles Control: Highlights and.
CANCER CONTROL NHPA’s. What is it? Cancer is a term to describe a diverse group of diseases in which some of the cells in body become defective. The following.
 2007 Johns Hopkins Bloomberg School of Public Health Section B Tracking Tobacco-Related Death and Disease.
FIOH / Tampere Occupational cancer Tööga seotud kopsuhaigused Tartu, oktoober 2003 OCCUPATIONAL LUNG CANCER Panu Oksa Soome Töötervishoiu Instituut.
VITAL STATISTICS FAJAR AWALIA YULIANTO COMMUNITY RESEARCH PROGRAM1.
THE PEP Sub-regional workshop September 2013 Health effects of particulate matter: Policy implications for EECCA countries Marie-Eve Héroux Technical Officer,
Tsuyoshi Kawakami, MD, PhD Senior OSH Specialist ILO Subregional Office for East Asia Towards the elimination of asbestos-related diseases - Common challenges.
Phusit Prakongsai Kanitta Bundhamcharoen Kanjana Tisayatikom Viroj Tangcharoensathien International Health Policy Program (IHPP) Presentation to IHPP Journal.
International High-Level Expert Conference on Chemical Safety and Rotterdam Convention: Policies and Practices in Russia 14 –15 October 2010, in Moscow.
Dr Heather O Dickinson Department of Child Health University of Newcastle
Air Quality and Health in the Eastern Mediterranean Region 1st SDS/WAS Africa Middle East workshop on the Health Impact of Airborne Dust Amman, Jordan.
Global and Regional estimates of the Burden Due to Ambient Air Pollution: results from GBD ST AFRICA/MIDDLE-EAST EXPERT MEETING AND WORKSHOP ON THE.
Occupational cancer Dr.Omid Aminian
COPD Local Burden. Population Prevalence of GOLD Stage I and Stage II & Doctor Diagnosed COPD in Manila, Philippines Source: BOLD Study, 2007;Dantes R.
Health Statistics and Informatics Non-communicable diseases A global overview.
The Universal Periodic Review. Living Conditions  There are no clear laws which regulate the living conditions of domestic workers.  Singapore's work.

1 Grassroots Asbestos Campaign in Asia Sanjiv Pandita Asian Ban Asbestos Network Geneva, 2015.
Mesothelioma in the South West of England : Trends, geographical distribution and gender differences Dr Sean McPhail, Andy Pring, Dr Julia Verne (contact.
The occupations of mesothelioma cases in the South West Region, Hampshire and the Isle of Wight A Evans*, A Pring, S McPhail and J Verne.
COPD Local Burden The Philippines. COPD A Global Health Concern COPD a growing cause of morbidity & mortality worldwide 5 th leading cause of death (2002)
Regional Workshop on Viral Hepatitis – WHO SEAR
COUNTRY REPORT ON HEALTH STATUS LITHUANIA Jurate Klumbiene Institute for Biomedical Research Kaunas University of Medicine Meeting on adult premature mortality.
Tobacco control: Best practices
Projected global distribution of total deaths (58 million) by major cause, 2005 Kathleen Strong et al, Lancet 2005; 366: 1578–82.
DETERMINING RISK FOR ASBESTOS-RELATED MALIGNANCY: LUNG CANCER
Gender difference in age, risk factors and histological characteristics of lung cancer patients, presented to the Respiratory Unit of Teaching Hospital.
Texila American University (TAU) School of Public Health Capstone Project for Presentation to the TAU 3rd International Scientific e-Conference Title:
Asbestos: Future Initiatives
5th International Seminar on Asian Asbestos Initiative
Hugh Robertson, Senior Health and Safety Officer, TUC
Summary of Fire Fighter Cancer Cohort Studies
Prepared by staff in Prevention and Cancer Control.
Saskatchewan Asbestos Disease Awareness Organization
Key messages Perviz Asaria, et al. Lancet 2007; 370:
Research, Monitoing and Surveillance of Smokeless tobacco use
Sustainability Analysis for Alternative Roofing Materials to Reduce Asbestos Use in Sri Lanka Student Name :Nuwan Ariyawansha Academic supervisor :Professor.
Presentation transcript:

National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok th Aug 2008

Summary of Presentation Why estimates? Data sources and approach Methods used in Estimation. Limitations of the methods used Conclusions and recommendations National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Asbestos Consumption in World and SEARO (Thousand – MT) National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Why Future Projections Policy makers need evidence for decision making Long latent period of Asbestos-related disease (asbestosis and malignances) Complaisance in developing countries due to non-availability of information on existing cases due to – Inadequate maintenance of records – Lack of awareness amongst affected population and physicians – Scarcity of experts to diagnose asbestos-related diseases – Misinformation National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Why Future Projections Significant linear correlation exists between asbestos used and cases of mesothelioma and asbestosis after 3 decades (Ro-Ting Len et al Lancet 2007; 369: 844–49; Dtechn, Int J Occ Env Hlth, 2004, 10:22 -25) The quantity of asbestos consumed can be as predictor of estimates cases of asbestos-related disease after the latent period. National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Available methods for estimates Ro-Ting Len et al Lancet 2007; 369: 844–49 – All mesothelioma in male = x ACKCP – All mesothelioma in female = x ACKCP – Asbestosis in male = x ACKCP – Asbestosis in female = x ACKCP Dtechn, Int J Occ Env Hlth, 2004, 10: – Y (cases/million/year) = 6.82 X kg/capita/year) or 1 death from mesotheolima per 170 tons of asbestos use. Global Trade Unions on Occupational Health and Safety profiling of countries – 170 tons of asbestos use = 1.6 lung cancer, 1 case of mesothelioma and 0.7 cases of asbestosis ACKCP = Annual consumption of asbestos in Kg/per capita per year National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Production, imports and exports of asbestos (MT) in SEAR countries in 2006 SEAR CountryProductionImportsExports Apparent Consumption India 20,000306, ,050 Indonesia --36, ,337 Sri Lanka --7,954--7,954 Thailand --98, ,280 Total20,000452, ,516 National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Estimated Annual burden of Asbestos-related Diseases in SEAR countries MesotheliomaLung CancerAsbestosisTotal India Indonesia Sri Lanka Thailand All countries National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Limitations Assumption of – Similarity in exposures and precautions. – Similarity in susceptibility – Exposure to other modulating factors e.g. age of first exposure, life expectancy, exposure to other carcinogens e.g. tobacco smoke and/or other environmental carcinogens. National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.

Conclusions and recommendations In recent years there is significant increase in consumption of asbestos in SEAR countries Extrapolation of results of results of well accepted eco- epidemiological studies indicate possible epidemic of asbestos-related diseases including cancer in near future. Asbestos can not be handled safely and safer substitutes are available There is urgent need to take adequate steps to avert the future catastrophe. National workshop on ”Strategies of Elimination of Asbestos-Related Disease“ Richmond Hotel, Bangkok, 5-6 th Aug 08.