CatDogRat Dog3 Rat45 Cow676 Barbara Holland Phylogenetics Workhop, 16-18 August 2006 Cat Dog Rat Cow 1 1 2 24 Distance Based Methods for estimating phylogenetic.

Slides:



Advertisements
Similar presentations
Computing a tree Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.
Advertisements

An Introduction to Phylogenetic Methods
Computing a tree Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.
Phylogenetics - Distance-Based Methods CIS 667 March 11, 2204.
Phylogenetic reconstruction
Maximum Likelihood. Likelihood The likelihood is the probability of the data given the model.
Molecular Evolution Revised 29/12/06
Lecture 7 – Algorithmic Approaches Justification: Any estimate of a phylogenetic tree has a large variance. Therefore, any tree that we can demonstrate.
CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Phylogenetic Reconstruction: Distance Matrix Methods Anders Gorm Pedersen Molecular Evolution Group Center for.
. Computational Genomics 5a Distance Based Trees Reconstruction (cont.) Modified by Benny Chor, from slides by Shlomo Moran and Ydo Wexler (IIT)
Heuristic alignment algorithms and cost matrices
Distance matrix methods calculate a measure of distance between each pair of species, then find a tree that predicts the observed set of distances.
Multiple Sequence Alignment Algorithms in Computational Biology Spring 2006 Most of the slides were created by Dan Geiger and Ydo Wexler and edited by.
Distance Methods. Distance Estimates attempt to estimate the mean number of changes per site since 2 species (sequences) split from each other Simply.
. Distance-Based Phylogenetic Reconstruction ( part II ) Tutorial #11 © Ilan Gronau.
Distance methods. UPGMA: similar to hierarchical clustering but not additive Neighbor-joining: more sophisticated and additive What is additivity?
In addition to maximum parsimony (MP) and likelihood methods, pairwise distance methods form the third large group of methods to infer evolutionary trees.
The Tree of Life From Ernst Haeckel, 1891.
Branch lengths Branch lengths (3 characters): A C A A C C A A C A C C Sum of branch lengths = total number of changes.
Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic.
Multiple sequence alignment
CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Distance Matrix Methods: Models of Evolution Anders Gorm Pedersen Molecular Evolution Group Center for Biological.
Phylogenetic Trees Tutorial 6. Measuring distance Bottom-up algorithm (Neighbor Joining) –Distance based algorithm –Relative distance based Phylogenetic.
Distance-Based Phylogenetic Reconstruction Tutorial #8 © Ilan Gronau, edited by Itai Sharon.
CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Phylogenetic Reconstruction: Distance Matrix Methods Anders Gorm Pedersen Molecular Evolution Group Center for.
Building Phylogenies Distance-Based Methods. Methods Distance-based Parsimony Maximum likelihood.
CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Distance Matrix Methods Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis.
Phylogenetic trees Tutorial 6. Distance based methods UPGMA Neighbor Joining Tools Mega phylogeny.fr DrewTree Phylogenetic Trees.
Phylogenetic trees Sushmita Roy BMI/CS 576
9/1/ Ultrametric phylogenies By Sivan Yogev Based on Chapter 11 from “Inferring Phylogenies” by J. Felsenstein.
Multiple Sequence Alignments and Phylogeny.  Within a protein sequence, some regions will be more conserved than others. As more conserved,
Phylogenetic Analysis. 2 Introduction Intension –Using powerful algorithms to reconstruct the evolutionary history of all know organisms. Phylogenetic.
Parsimony and searching tree-space Phylogenetics Workhop, August 2006 Barbara Holland.
Phylogenetics Alexei Drummond. CS Friday quiz: How many rooted binary trees having 20 labeled terminal nodes are there? (A) (B)
1 Dan Graur Molecular Phylogenetics Molecular phylogenetic approaches: 1. distance-matrix (based on distance measures) 2. character-state.
Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.
Molecular phylogenetics 1 Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections
BINF6201/8201 Molecular phylogenetic methods
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all.
Phylogenetic Prediction Lecture II by Clarke S. Arnold March 19, 2002.
CP Summer School Modelling for Constraint Programming Barbara Smith 2. Implied Constraints, Optimization, Dominance Rules.
Calculating branch lengths from distances. ABC A B C----- a b c.
Using traveling salesman problem algorithms for evolutionary tree construction Chantal Korostensky and Gaston H. Gonnet Presentation by: Ben Snider.
Ch.6 Phylogenetic Trees 2 Contents Phylogenetic Trees Character State Matrix Perfect Phylogeny Binary Character States Two Characters Distance Matrix.
Fabio Pardi PhD student in Goldman Group European Bioinformatics Institute and University of Cambridge, UK Joint work with: Barbara Holland, Mike Hendy,
Phylogenetic Analysis Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics Figures from Higgs & Attwood.
Maximum Likelihood Given competing explanations for a particular observation, which explanation should we choose? Maximum likelihood methodologies suggest.
Phylogeny Ch. 7 & 8.
1 CAP5510 – Bioinformatics Phylogeny Tamer Kahveci CISE Department University of Florida.
Parsimony and searching tree-space. The basic idea To infer trees we want to find clades (groups) that are supported by synapomorpies (shared derived.
Distance-Based Approaches to Inferring Phylogenetic Trees BMI/CS 576 Colin Dewey Fall 2010.
Statistical stuff: models, methods, and performance issues CS 394C September 3, 2009.
Distance-based methods for phylogenetic tree reconstruction Colin Dewey BMI/CS 576 Fall 2015.
CSCE555 Bioinformatics Lecture 13 Phylogenetics II Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:
Distance-based phylogeny estimation
Phylogeny - based on whole genome data
Distance based phylogenetics
dij(T) - the length of a path between leaves i and j
Inferring a phylogeny is an estimation procedure.
Clustering methods Tree building methods for distance-based trees
Multiple Alignment and Phylogenetic Trees
The Tree of Life From Ernst Haeckel, 1891.
Inferring phylogenetic trees: Distance and maximum likelihood methods
Phylogenetic Trees.
CS 581 Tandy Warnow.
Lecture 7 – Algorithmic Approaches
Phylogeny.
Presentation transcript:

CatDogRat Dog3 Rat45 Cow676 Barbara Holland Phylogenetics Workhop, August 2006 Cat Dog Rat Cow Distance Based Methods for estimating phylogenetic trees

How do we get distance data? Observed vs. actual distances Correcting for hidden changes Not all distances are “tree-like” Tree building: clustering methods  UPGMA  Neighbor-joining Tree building: optimality criteria  Least Squares Overview

What do edge lengths represent? In some trees edges represent time, in which case all modern sequences should be the same distance from the root. Sometimes edge lengths represent the product μ∙t of the rate of change μ and time t in which case different tips can be different distances from the root provided that the rate has changed across the tree. Cat Dog Rat Cow

Distance matrices There are many ways of building phylogenetic trees, one family of methods uses a distance matrix as a starting point. A distance matrix is a table that indicates pairwise dissimilarity, for instance... CatDogRatCow Cat0247 Dog2056 Rat4503 Cow7630 ABCD B C D E

Properties of distances d(x,x) = 0 d(x,y) = d(y,x) d(x,y) + d(y,z) >= d(x,z) (the triangle inequality) The distances used in phylogenetics always have the first two properties but sometimes not the third.

I want to build a tree - will any old distances do? Not all distances will be suitable for building trees. Tree-building methods do not discriminate, they will return a tree regardless of whether you give them roadmap distances or distances based on a sequence alignment. Some distances are perfectly “tree-like”.

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

Perfectly “tree-like” distances CatDogRat Dog3 Rat45 Cow676 Cat Dog Rat Cow

The 4-Point Condition Distances that fit exactly on a tree can be characterised by a condition on any quartet i, j, k, l (i.e. it must hold true for any 4 taxa). We write d(x,y) for the distance between x and y. Given 4 taxa i, j, k, l, of the 3 sums  d(i,j) + d(k,l)  d(i,k) + d(j,l)  d(i,l) + d(j,k) The largest two are equal. Distances with this property are called additive, because the weights on the paths along the tree add up to the values in the distance matrix.

Why is this true of tree-like distances? i j k l i j k l i j k l d(i,j)+d(k,l) d(i,k)+d(j,l) d(i,l)+d(j,k) < =

Clock-like distances An even stricter condition on distances is that they fit on a clock-like tree. Distances with this property are called ultrametric. time ijk d(i,k) = d(j,k) > d(i,j)

Distances can be derived from Multiple Sequence Alignments (MSAs). The most basic distance is just a count of the number of sites which differ between two sequences divided by the sequence length. These are sometimes known as p-distances. Cat ATTTGCGGTA Dog ATCTGCGATA Rat ATTGCCGTTT Cow TTCGCTGTTT CatDogRatCow Cat Dog Rat Cow Where do we get distances from?

Other sources of distances Immunological data  Similarity between proteins A and B can be assessed by how well the immune system responds to B after already having seen A. DNA/DNA hybridization  more similar DNA hybrids "melt" at higher temperatures Fragment length polymorphism  “Chop DNA up” using restriction enzymes.  Amplify some fragments usign PCR  Run the fragments out on an electrophoretic gel  Compare profiles of different genomes BLAST scores

Observed distances usually underestimate the true number of changes ATTTGCGGTAATCTGCGATA ATTTGCGATA Actual Changes = 2 Observed Changes = 2

Parallel changes Reversals Superimposed changes ATTTGCGGTAATCTGCGATA ATTCGCGATA Actual Changes = 4 Observed Changes = 2

Parallel changes Reversals Superimposed changes ATTTGCGGTAATCTGCGATA ATTTGCGATA Actual Changes = 4 Observed Changes = 2 ATTCGCGATA

Parallel changes Reversals Superimposed changes ATTTGCGGTAATCTGCGATA ATTTGCGATA Actual Changes = 3 Observed Changes = 2 ATTTGCGTTA

Given a statistical model of how point mutations occur it is possible to estimate the true genetic distance from the observed distance. Correcting for hidden changes

Correcting under a simple model The Jukes-Cantor model states that all states {A,C,G,T} and all changes between states, e.g. A→C, are equally likely. AG C T u /3 As a mathematical conviencence imagine we have a rate 4 u /3 of change to a random state, this includes the possibility of a state changing to itself.

A Poisson process The probability of no change at a site over time t is e -4/3ut The probability of at least one event is then 1- e -4/3ut The probability of at least one event that leads to a different state from the one we started at is ¾(1- e -4/3ut ) as one time out of four we will “mutate” to the same base we started with. The expected observed distance d given a true genetic distance of ut is d = ¾(1- e -4/3ut ) Inverting this formula gives our correction D = ut = -3/4 ln (1-4/3d)

Correction for hidden changes has been shown (both theoretically and by simulation studies) to improve accuracy. However, this is not universally true. If data is clock-like then corrections will not change the relative size of the distances However, the more complicated the model is the larger the variance (error) of the distances will become. Correcting for hidden changes

Under the Jukes-Cantor model where all point mutations are equally likely the correction is: D actual = ¾ ln(1 – 4/3*d observed )

error

An interesting observation Uncorrected distances always obey the triangle inequality d(x,y) + d(y,z) >= d(x,z) But corrected distance do not. E.g. if sequences a and b differ at 10 / 100 sites and sequences b and c differ at a different 10 / 100 sites the uncorrected distances are d(a,b) = d(b,c) = 0.1, d(a,c) = 0.2 and the corrected distances (under the JC model) are D(a,b) = D(b,c) = 0.107, D(a,c) = 0.233

Tree building - UPGMA UPGMA works by progressively clustering the most similar taxa until all the taxa form a rooted clock-like tree. 1. Find the smallest entry in the distance matrix, say d(x,y). 2. Form a new internal node, z, that is a parent to x and y and set the edge lengths from z to x and z to y to half d(x,y). 3. Update the distance matrix by setting the distances from the new node z to all the other taxa to be the average distance between groups x and y. REPEAT until all groups have been joined.

What precisely is meant by the average distance? If we a joining two groups i and j that already have n i and n j members we update the distances using

d(i,j) A B C D E F A- B 2 - C D E F G G 11 A B I C D E F A B D E F G Step 2 - Cluster taxa A and B, form a new internal node I Calculate the lengths of the new edges d(A,I)=d(B,I)=1/2 d(A,B)=1 Step 1 – Find the smallest entry in the distance matrix Step 3 – Update the distance matrix d(C,I) = ½(d(A,C) + d(B,C)) = 4 etc... C

Step 2 - Cluster taxa C and D, form a new internal node II Calculate the lengths of the new edges d(C,II)=d(D,II)=1/2 d(C,D)=1 11 A B I E F 11 C D II 11 A B I C D E F G d(i,j) I (A+B) C D E F - C 4 - D E F G Step 1 – Find the smallest entry in the distance matrix Step 3 – Update the distance matrix d(I,II)=1/2(d(I,C)+d(I,D)) = 4 d(E,II) = ½(d(E,C) + d(E,D)) = 7 etc... G

A B I A B C D E F C D E F G G A B I E F G C D II A BC D I III E F G I II III IV A BC D F E G I II III IV A BC D F E G V I II III IV A BC D F E V G VI And so on......until we have a rooted tree. But, is it the right tree?

d(i,j) A B C D E F A - B 2 - C D E F G A B C D E G F I II III IV A BC D F E V G VI = The tree that matches the distances is not recovered by UPGMA. UPGMA is not consistent for additive distances

Inconsistency When a method is given “perfect” data but still gets the wrong tree it is said to be inconsistent. UPGMA is inconsistent for data that isn’t ultrametric (clock-like). Next we’ll look at a method that is consistent for any additive data.

Neighbor-joining (NJ) NJ works by progressively clustering taxa until all the taxa form an unrooted tree. 1. Rather than using the distance matrix directly to determine which taxa should be clustered at each stage, NJ uses the S matrix where S(i,j) = (N-2)d(i,j) - R(i) - R(j) N is the number of taxa. R(i) is the sum of the ith row in the distance matrix. R(j) is the sum of the jth row in the distance matrix. 2. Find the smallest entry in the S matrix, say S(x,y).

3. Form a new internal node, z, that is a parent to x and y and calculate the edge lengths from z to x and z to y. d(x,z) = 1/(2(N-2))[(N-2)d(x,y) + R(x) – R(y)] d(y,z) = d(x,y) – d(x,z) 4. Update the distance matrix d(w,z) = ½ (d(x,w) + d(y,w) – d(x,y)) REPEAT until only two things are left to be joined.

NJ Example CatDogRat Dog3 Rat45 Cow676 CatDogRat Dog-22 Rat-20 Cow D= S= R(cat) = 13 R(dog) = 15 R(rat) = 15 R(cow) = 19 e.g. S(cat,dog) = (4-2)x3 – 13 – 15 = -22 S(cat,rat) = (4-2)x4 – 13 – 15 = -20 Step 1

NJ Example CatDogRat Dog3 Rat45 Cow676 CatDogRat Dog-22 Rat-20 Cow D= S= Cat Dog Rat Cow z Step 3 d(cat,z) = ¼[2d(cat,dog) + R(cat) – R(dog)] = ¼ [ – 15] = 1 d(dog,z) = 3-1 = 2 Step 1 Step 2

Cat Dog Rat Cow z Step 4 d(z,rat) = ½ [d(cat,rat) + d(dog,rat) – d(cat,dog)] = ½ [4 + 5 – 3] = 3 d(z,cow) = ½ [6 + 7 – 3] = 5

Global vs Local methods UPGMA and NJ are local construction methods. At each step they pick they best pair of taxa to cluster, once a decision is made it cannot be unmade. This makes these methods very fast. There are also global methods for making trees based on distances. These evaluate an optimality criterion on each possible tree and then pick the tree with the best score. Examples of global methods for distance data include least squares and minimum evolution. Because the number of trees grows very quickly with the number of taxa, these methods are slow.

Least Squares We would like the path lengths on the tree we choose to be as close as possible to the corresponding values in the distance matrix. With additive data we can always find a tree where the path length distances and the distance matrix match exactly. However, most data isn’t perfect... We can try and minimise the discrepency between the observed distances and the tree distances using a least squares approach.

A family of least squares methods w ij = 1 unweighted least squares (Cavalli-Sforza and Edwards 1967) w ij =1/D ij w ij = 1/D ij 2 (Fitch and Margoliash 1967)

Picking the best weights for a given tree The tree distances d ij can be represented by the equation where x ij,k is an indicator variable that is 1 if edge k lies on the path from i to j and 0 otherwise. We want to find edge weights e k that minimise

The indicator variables can be expressed in matrix format E A B C D e1e1 e2e2 e3e3 e4e4 e5e5 e6e6 e7e X = Each row of X corresponds to a path in the tree We can write D = Xe D AB D AC D AD D AE D BC D BD D BE D CD D CE D DE D = e1e2e3e4e5e6e7e1e2e3e4e5e6e7 e =

Experience the joy of linear algebra D=Xe X T D = (X T X)e e = (X T X) -1 X T D This assumes that the weights w ij = 1

Minimum evolution Uses the least squares method to fit the branch lengths for each tree BUT uses a different optimality criterion than least squares. Prefers the tree with the shortest sum of branch lengths

Review Observed distances derived from sequence alignments will always underestimate the true number of mutations. Hence it is ususally a good idea to correct for these hidden changes. Clustering methods like UPGMA and Neighbor- joining are very fast as they only make local decisions and never backtrack. These methods are often used as a starting point for heuristic searches. There are also optimality criteria that use distances as input, e.g. Least squares and minimum evolution.

Review Not all distances can be fit perfectly onto a tree. Methods can be inconsistent, for example for some non-clocklike distances UPGMA is guaranteed to recover the wrong tree. UPGMA is consistent for clock-like distances and NJ is consistant for any additive distances.