Finding relationships and differences by bar-coding jellyfish species Dr. David Pontin

A beginning

Barcodes Barcode: A short series of vertical bars representing the digits 0-9, commonly used for product identification. DNA Barcode: A short length of DNA that is able to differentiate between species. caggggcacgaatcagttaccaaatcctccaattagaact ggcattacaaggaaaaagatcataacaaatgcatgagca gttactataacattatagagatgatcatctccaaacatggt accaggtcctgacaa

Looking for DNA Barcodes Mitochondrial DNA vs. Nuclear DNA “fast evolving” tips only of interest Must work in >90% of examples 650 bp length of Mitochondrial DNA called cytochrome c oxidase I or COI

DNA Barcoding today Formally Described Species :72,144 Total Barcode Records 871,435 Barcode of life project caggggcacgaatcagttaccaaatcctccaattagaact ggcattacaaggaaaaagatcataacaaatgcatgagca gttactataacattatagagatgatcatctccaaacatggt accaggtcctgacaa

A bit of controversy What constitutes a species? – Rule of thumb for insects is 2% divergence (13bp) Cryptic species/species complexes – DNA vs. morphology COI doesn't work for everything (plants) – Is one gene enough?

Physalia (Siphonophora) Completely pelagic Taxonomically ambiguous Abundant around New Zealand Passive surface dispersal

PhD. goals 1.Identify the species 2.Identify important oceanographic variables that influence bluebottle occurrence 3.Predict bluebottle occurrence

Portuguese Man o War Physalia physalis The Bluebottle Physalia utriculus

Bluebottle locations 54 specimens 13 locations COI and ITS sequenced

Likelihood trees COI ITS Physalia physalis

Genetic linkages (COI)

Hybridisation? Two explanations for the ones that “jumped ship” –Hybridisation –Ancestral polymorphisum More likely to be hybridisation –Range overlap –Broad cast spawning –Reported in the Anthozoa

Western Australia 1 Doesn't fit any clan If removed, green clan is well supported What’s going on?

Conflict A B Tree 1 DC A B D C Tree 2 60%40%

Achieving goals (or not) We still don’t know what species of bluebottle occurs in New Zealand But it is a species complex needing a global review COI was a good choice but results heighted the need for other markers with “difficult” species

Hypothesised movement of Physalia

Hypothesised blooming zone

Synergy Both techniques confirm the existence of two circulatory systems Molecular data shows what’s there and the models suggest how it got there Methods allow potential blooming areas to be inferred so that other evidence can be examined in a directed manner Not possible if methods are considered independently

Wider Picture How many other jellyfish species could be the same? What does that mean for New Zealand's marine biodiversity? Population identification has several usages –Pest control: resistance –Population linkages