Gene Control in Eukaryotes In eukaryotic cells, the ability to express biologically active proteins comes under regulation at several points: 1. Chromatin.

Slides:



Advertisements
Similar presentations
Control of Gene Expression
Advertisements

Gene Expression in Prokaryotes. Why regulate gene expression? It takes a lot of energy to make RNA and protein. It takes a lot of energy to make RNA and.
Gene Expression and Control Part 2
Chapter 22 Nucleic Acids and Protein Synthesis
Regulation of gene expression Premedical - Biology.
GENETICS ESSENTIALS Concepts and Connections SECOND EDITION GENETICS ESSENTIALS Concepts and Connections SECOND EDITION Benjamin A. Pierce © 2013 W. H.
Control of Gene Expression in Prokaryotes
Chapter 18 Regulation of Gene Expression.
To understand the concept of the gene function control. To understand the concept of the gene function control. To describe the operon model of prokaryotic.
Regulation of gene expression References: 1.Stryer: “Biochemistry”, 5 th Ed. 2.Hames & Hooper: “Instant Notes in Biochemistry”, 2 nd Ed.
12/29/102 Functional segments of DNA Code for specific proteins Determined by amino acid sequence One gene-one protein hypothesis (not always true)
Gene Activity: How Genes Work
10-1 Copyright  2005 McGraw-Hill Australia Pty Ltd PPTs t/a Biology: An Australian focus 3e by Knox, Ladiges, Evans and Saint Chapter 10: The genetic.
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.
Translation and Transcription
Protein Synthesis.
Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Essentials of the Living World Second Edition George B. Johnson Jonathan B. Losos Chapter 13 How Genes Work Copyright © The McGraw-Hill Companies, Inc.
Differential Expression of Genes  Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions  In multicellular.
17.4 – Protein Synthesis and Gene Expression gene expression – the transfer of genetic information from DNA to protein As described.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
Regulation of Gene Expression
Introns and Exons DNA is interrupted by short sequences that are not in the final mRNA Called introns Exons = RNA kept in the final sequence.
Control of gene expression Unit but different cells have different functions and look and act differently! WHY? Different sets of genes are expressed.
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
Regulation of Gene Expression Eukaryotes
Translation mRNA exits the nucleus through the nuclear pores In the cytoplasm, it joins with the other key players to assemble a polypeptide. The other.
Genetics: Chapter 7. What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how.
Chapter 16 Outline 16.4 Some Operons Regulate Transcription Through Attenuation, the Premature Termination of Transcription, Antisense RNA Molecules.
For the following replication fork, which strand would be leading? 5’ Top Strand Bottom Strand.
Transcription & Translation Chapter 17 (in brief) Biology – Campbell Reece.
Protein Synthesis Process that makes proteins
Chapter 7 Gene Expression and Control Part 2. Transcription: DNA to RNA  The same base-pairing rules that govern DNA replication also govern transcription.
Control of Gene Expression Chapter Proteins interacting w/ DNA turn Prokaryotic genes on or off in response to environmental changes  Gene Regulation:
Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.
Melanie Tavone. Curriculum Expectations D3.3 explain the steps involved in the process of protein synthesis and how genetic expression is controlled in.
Control of Gene Expression Chapter DNA RNA Protein replication (mutation!) transcription translation (nucleotides) (amino acids) (nucleotides) Nucleic.
 Homework:  Lab 6B Analysis Questions – due tomorrow  Problem Set will be due next Wednesday  Do Now: With your lab group…  Take out lab packet 
Controlling Gene Expression
PROTEIN SYNTHESIS HOW GENES ARE EXPRESSED. BEADLE AND TATUM-1930’S One Gene-One Enzyme Hypothesis.
Controlling Gene Expression. Control Mechanisms Determine when to make more proteins and when to stop making more Cell has mechanisms to control transcription.
Gene Regulation In 1961, Francois Jacob and Jacques Monod proposed the operon model for the control of gene expression in bacteria. An operon consists.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Transcription and Translation The Objective : To give information about : 1- The typical structure of RNA and its function and types. 2- Differences between.
Unit-II Synthetic Biology: Protein Synthesis Synthetic Biology is - A) the design and construction of new biological parts, devices, and systems, and B)
Translation- taking the message of DNA and converting it into an amino acid sequence.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Chapter 15. I. Prokaryotic Gene Control  A. Conserves Energy and Resources by  1. only activating proteins when necessary  a. don’t make tryptophan.
Chapter 12 Protein Synthesis. Central Dogma: DNA  RNA  Protein (the flow of genetic information)
Chapter 15. I. Prokaryotic Gene Control  A. Conserves Energy and Resources by  1. only activating proteins when necessary  a. don’t make tryptophan.
6/28/20161 GENE REGULATION Lac Operon &Trp Operon in Bacteria Salam Pradeep.
Gene Expression : Transcription and Translation 3.4 & 7.3.
Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.
The flow of genetic information:
Control of Gene Expression
Figure 18.3 trp operon Promoter Promoter Genes of operon DNA trpR trpE
Transcription and Translation.
Chapter 10 How Proteins are Made.
Molecular Mechanisms of Gene Regulation
Ch 18: Regulation of Gene Expression
Agenda 3/16 Genes Expression Warm Up Prokaryotic Control Lecture
Synthetic Biology: Protein Synthesis
PROTEIN SYNTHESIS An individual’s characteristics are determined by their DNA. The DNA code determines which proteins are made. The sequence of bases in.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
GENE EXPRESSION / PROTEIN SYNTHESIS
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Gene Regulation certain genes are transcribed all the time – constitutive genes synthesis of some proteins is regulated and are produced only when needed.
From gene to protein.
Presentation transcript:

Gene Control in Eukaryotes In eukaryotic cells, the ability to express biologically active proteins comes under regulation at several points: 1. Chromatin Structure: The physical structure of the DNA, as it exists compacted into chromatin, can affect the ability of transcriptional regulatory proteins (termed transcription factors) and RNA polymerases to find access to specific genes and to activate transcription from them. The presence modifications of the histones and of CpG methylation most affect accessibility of the chromatin to RNA polymerases and transcription factors.Chromatin Structure:chromatin 2. Epigenetic Control: Epigenesis refers to changes in the pattern of gene expression that are not due to changes in the nucleotide composition of the genome. Literally "epi" means "on" thus, epigenetics means "on" the gene as opposed to "by" the gene.Epigenetic Control

3. Transcriptional Initiation: This is the most important mode for control of eukaryotic gene expression. Specific factors that exert control include the strength of promoter elements within the DNA sequences of a given gene, the presence or absence of enhancer sequences (which enhance the activity of RNA polymerase at a given promoter by binding specific transcription factors), and the interaction between multiple activator proteins and inhibitor proteins.Transcriptional Initiation: 4. Transcript Processing and Modification: Eukaryotic mRNAs must be capped and polyadenylated, and the introns must be accurately removed (see RNA Synthesis Page). Several genes have been identified that undergo tissue-specific patterns of alternative splicing, which generate biologically different proteins from the same gene.RNA Synthesis Page

5. RNA Transport: A fully processed mRNA must leave the nucleus in order to be translated into protein. 6. Transcript Stability: Unlike prokaryotic mRNAs, whose half-lives are all in the range of 1 to 5 minutes, eukaryotic mRNAs can vary greatly in their stability. Certain unstable transcripts have sequences (predominately, but not exclusively, in the 3'-non-translated regions) that are signals for rapid degradation. 7. Translational Initiation: Since many mRNAs have multiple methionine codons, the ability of ribosomes to recognize and initiate synthesis from the correct AUG codon can affect the expression of a gene product. Several examples have emerged demonstrating that some eukaryotic proteins initiate at non-AUG codons. This phenomenon has been known to occur in E. coli for quite some time, but only recently has it been observed in eukaryotic mRNAs.Translational Initiation:

8. Small RNAs and Control of Transcript Levels: Within the past several years a new model of gene regulation has emerged that involves control exerted by small non-coding RNAs. This small RNA-mediated control can be exerted either at the level of the translatability of the mRNA, the stability of the mRNA or via changes in chromatin structure.Small RNAs and Control of Transcript Levels 9. Post-Translational Modification: Common modifications include glycosylation, acetylation, fatty acylation, disulfide bond formations, etc.Post-Translational Modification: 10. Protein Transport: In order for proteins to be biologically active following translation and processing, they must be transported to their site of action. 11. Control of Protein Stability: Many proteins are rapidly degraded, whereas others are highly stable. Specific amino acid sequences in some proteins have been shown to bring about rapid degradation.

Gene Control in Prokaryotes genes are clustered into operons: gene clusters that encode the proteins necessary to perform coordinated function prokaryotic genes that encode the proteins necessary to perform coordinated function are clustered into operons.

The lac operon consists of one regulatory gene (the i gene) and three structural genes (z, y, and a). The i gene codes for the repressor of the lac operon. The z gene codes for β-galactosidase (β-gal), for the hydrolysis of the disaccharide, lactose into its monomeric units, galactose and glucose. y gene codes for permease, increases permeability of the cell to β-galactosides. The a gene encodes a transacetylase. During normal growth on a glucose-based medium, the lac repressor is bound to the operator region of the lac operon, preventing transcription. However, in the presence of an inducer of the lac operon, the repressor protein binds the inducer and is rendered incapable of interacting with the operator region of the operon. RNA polymerase is thus able to bind at the promoter region, and transcription of the operon ensues.

The lac operon is repressed, even in the presence of lactose, if glucose is also present. This repression is maintained until the glucose supply is exhausted. The repression of the lac operon under these conditions is termed catabolite repression and is a result of the low levels of cAMP that result from an adequate glucose supply.

Transcription DNA is transcribed to make RNA (mRNA, tRNA, and rRNA) Transcription begins when RNA polymerase binds to the promoter sequence Transcription proceeds in the 5'  3' direction Transcription stops when it reaches the terminator sequence

Figure 8.7 The Process of Transcription

Figure 8.7 The Process of Transcription

Figure 8.11 RNA Processing in Eukaryotes

Figure 8.2 Translation mRNA is translated in codons (three nucleotides) Translation of mRNA begins at the start codon: AUG Translation ends at nonsense codons: UAA, UAG, UGA

Figure 8.2 The Genetic Code 64 sense codons on mRNA encode the 20 amino acids The genetic code is degenerate tRNA carries the complementary anticodon

Figure 8.9 The Process of Translation Components needed to begin translations come together.

Figure 8.9 The Process of Translation On the assembled ribosome, at tRNA carrying the first amino acid in paired with the start codon on the mRNA.the place where this firsts tRNA sits is called the p site.A tRNA carrying the second amino acid approaches.

Figure 8.9 The Process of Translation The second codon of the mRNA pairs with a tRNA carrying the second amino acids joins to the seconds by a peptide bond. This attaches the polypeptide to the tRNA in the p site.

Figure 8.9 The Process of Translation The ribosome moves along the mRNA until the second tRNA is in the p site. The next codon to be translated is brought into the a site. The firsts tRNA now occupies the e site.

Figure 8.9 The Process of Translation The second amino acid is paired with the start codon on the mRNA. Is release from the e site.

Figure 8.9 The Process of Translation The ribosome continues to move along the mRNA and new amino acids are added to the polypeptide

Figure 8.9 The Process of Translation When the ribosome reaches a stop codon, the polypeptide is released.

Figure 8.9 The Process of Translation Finally, the last tRNA is released,and the ribosome comes apart. The released polypeptide forms a new protein.

Regulation Constitutive genes are expressed at a fixed rate Other genes are expressed only as needed Repressible genes Inducible genes Catabolite repression

Figure 8.12 Operon

Figure 8.12 Inducible operon (lac operon)

Figure 8.12 Inducible operon (lac operon)

Figure 8.13 Repressible operon (trp operon)

Figure 8.13 Repressible operon (trp operon)

The trp operon encodes the genes for the synthesis of tryptophan. This cluster of genes regulated by a repressor that binds to the operator sequences. The activity of the trp repressor for binding the operator region is enhanced when it binds tryptophan known as a corepressor. Since the activity of the trp repressor is enhanced in the presence of tryptophan, the rate of expression of the trp operon is graded in response to the level of tryptophan in the cell. Expression of the trp operon is also regulated by attenuation.

Attenuation The attenuator plays an important regulatory role in prokaryotic cells because of the absence of the nucleus in prokaryotic organisms. The attenuator refers to a specific regulatory sequence that, when transcribed into RNA, forms hairpin structures to stop transcription when certain conditions are not metprokaryoticnucleusprokaryoticorganisms

CATABOLITE REPRESSION Many inducible operons are not only controlled by their respective inducers and regulatory genes, but they are also controlled by the level of glucose in the environment. The ability of glucose to control the expression of a number of different inducible operons is called CATABOLITE REPRESSION.

Figure 8.14 (a) Growth on glucose or lactose alone (b) Growth on glucose and lactose combined Catabolite Repression

Lactose present, no glucose Lactose + glucose present Figure 8.15