Final Presentation 11-16-2012. Sample Preparation Nextera TruSeq RiboZero Strand Specific Clontech smRNA 16s.

Slides:

Advertisements

Similar presentations

RNA-seq library prep introduction

Advertisements

An Introduction to Studying Expression Data Through RNA-seq

Determination of host-associated bacterial communities In the rhizospheres of maize, acorn squash, and pinto beans.

Advancing Science with DNA Sequence Metatranscriptomics: Challenges and Progress Shaomei He DOE Joint Genome Institute AUG.

Determination of host-associated bacterial communities In the rhizospheres of maize, acorn squash, and pinto beans.

Recombinant DNA Technology. Recombinant DNA Technology combines DNA from different sources – usually different species Utility: this is done to study.

MCB Lecture #9 Sept 23/14 Illumina library preparation, de novo genome assembly.

It’s Not Magic: Automated NGS Sample Preparation Zach Smith, MS Senior Application Scientist.

Ribosome Profiling Library Preparation with SOLID Nate Blewett MGL Users Group May 4 th 2015.

Additional Powerful Molecular Techniques Synthesis of cDNA (complimentary DNA) Polymerase Chain Reaction (PCR) Microarray analysis Link to Gene Therapy.

The SOLiD System: Next-Generation Sequencing Overview of the SOLiD System –  Scalable  Accurate Ultra High Throughput  Flexible  Mate Pairs.

University of Oklahoma Genome Center4/14/12.

11 © 2009 PerkinElmer © 2010 PerkinElmer November 20, 2012 DNA Services Overview.

Diabetes and Endocrinology Research Center The BCM Microarray Core Facility: Closing the Next Generation Gap Alina Raza 1, Mylinh Hoang 1, Gayan De Silva.

Zachary Bendiks. Jonathan Eisen  UC Davis Genome Center  Lab focus: “Our work focuses on genomic basis for the origin of novelty in microorganisms (how.

Lecture 3 Lecture 2 catch up Vector structure Copy number control

Molecular Biology Dr. Chaim Wachtel April 4, 2013.

CULTURE INDEPENDENT ANALYSIS OF MICROBIAL COMMUNITIES IN SOIL

Genomic walking (1) To start, you need: -the DNA sequence of a small region of the chromosome -An adaptor: a small piece of DNA, nucleotides long.

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

Genomics – Next-Gen sequencing and Microarrays

Library screening Heterologous and homologous gene probes Differential screening Expression library screening.

Metatranscriptomics: Challenges and Progress Cindi Hoover DOE Joint Genome Institute May 17, 2012.

DNA contamination can often occur in quantitative reverse transcription – polymerase chain reactions (QRT-PCR), and should be removed in order to avoid.

Remember the limitations? –You must know the sequence of the primer sites to use PCR –How do you go about sequencing regions of a genome about which you.

RNA Processing By: Kelvin Liu, Jeff Wu, Alex Eishingdrelo.

Intro to RNA-seq July 13, Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on.

Céline Cluzeau, Ph.D. Postdoctoral Visiting Fellow Biological pathways influencing Purkinje cell survival in Niemann- Pick disease type C1.

How will new sequencing technologies enable the HMP? Elaine Mardis, Ph.D. Associate Professor of Genetics Co-Director, Genome Sequencing Center Washington.

Metatranscriptomics: Challenges and Progress

Next-Generation Sequencing of Microbial Genomes and Metagenomes

Preparation of RNA and QC for Expression Profiling John Kenny Centre for Genomic Research, University of Liverpool.

1. 2 VARIANTS OF PCR APPLICATIONS OF PCR MECHANICS OF PCR WHAT IS PCR? PRIMER DESIGN.

A Novel Approach to Identifying Differential Gene Expression Alexander Richardson Robert Pignolo.

DNA library Genomic libraryenomic library cDNA library Genomic Library: DNA fragments representing the entire genome of an organism. cDNA Library :Complementary.

Lecturer Bahiya Osrah.  RNA exist as a single strand.  Ribose Sugar (5 carbon sugar)  Phosphate group  Adenine, Uracil, Cytosine, Guanine  For RNA,

How to Give a Good Talk. Why do we care? We want to learn from the talk We want to stay awake Presentation skills are important in your future.

Sequencing Transcriptomes Do Me a SOLiD. Overview – Library Construction RNA ◦Isolate & Bioanalyze ◦rRNA Depletion ◦Fragment ◦Bioanalyze Amplified Library.

Library QA & QC Day 1, Video 3

16S rRNA Experimental Design

Presented By: Emily Lamoureux

Next generation sequencing

RNA-Seq for the Next Generation RNA-Seq Intro Slides

Příprava celometagenomových knihoven (shotgun)

Overview of hybrid capture preparation for sequencing

DNA Sequencing -sayed Mohammad Amin Nourion -A’Kia Buford

exRNA Metadata Standards

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Experimenttal part.

Sequencing Methods VEB.

Denaturing Gradient Gel Electrophoresis

Primer-Dimer Formation: The Problem and the Solution

cDNA Synthesis Service

Workshop on the analysis of microbial sequence data using ARB

Reverse Complement PCR: fast, low cost amplicon based NGS

Teagasc/APC Sequencing Facility

Small RNA Sample Preparation

CHAPTER 12 DNA Technology and the Human Genome

mRNA Sequencing Sample Preparation

Consequences of T‐DNA insertion on SWP expression in swp mutant.

Genome scaffold ORF A   ORF B RNASeq reads

ULTRASEQUENCING. Next Generation Sequencing: methods and applications.

Overview of the proposed standard operating procedure (SOP) for rapid next-generation sequencing library preparation and inactivation of ssRNA+ viruses.

RNA sequencing (RNA-Seq) and its application in ovarian cancer

Digital Gene Expression – Tag Profiling Sample Preparation

Genomic DNA Sample Preparation

Sequence Analysis - RNA-Seq 1

Derek de Rie and Imad Abuessaisa Presented by: Cassandra Derrick

Presentation transcript:

Final Presentation

Sample Preparation Nextera TruSeq RiboZero Strand Specific Clontech smRNA 16s

Nextera Quantification issues Nextera libraries consistently have lower qPCR concentrations compared to BA; usually about half as concentrated Illumina Sequences

My Guess?

Nextera Sequences CTTAATGATACGGCGACCACCGAGATCTACACTAGATCGCT CGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCGTGATG GACTGCCGTAACGGCGACCTGCTGTGCATGGCCTCCGCGC CGAGCTTCGACGCCAACCGGTTCGTGCGGGGGCTGTCCG GTCCTGAGTACAAGGCCCTGGCCGAGTACGAGCGCAAGCC GCTGCTCGACAAGTCGATGACCGGCCTGTTTCCGCCCGGC TCGACCTTCAAGCCCACGGTGGGTCTGGCCGCCCTGGCCG CCGGCATCGATCCCGAGGTCCGGGTCAACTGTCCGGGCAG CTGGTACTATGGCGGTCGGGTGTGGCGTTGCTGGGAGAAG GGCGGCCACGGCCTGTCTCTTATACACATCTCCGAGCCCAC GAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG

TruSeq 100ng – 4000ng total RNA input “yield” ~70% PolyA based purification Eukaryotic only RINs should be greater than 9

RiboZero 1- 3ug total RNA input, can handle fragmented RNA rRNA depletion, magnetic beads with capture probes against rRNA Creates libraries with mRNA and non-coding RNAs Species specific reagents, prokaryotic and eukaryotic High rRNA background with input above 3ug; might be worth doing rRNA removal twice

Strand Specific Requires greater than 1ug total RNA input dUTP 2 nd strand marking protocol Need to add Actinomycin D during 1 st strand synthesis TruSeq and RiboZero protocols can be used for strand specific preparations

Clontech 100pg total RNA input polyA based purification, eukaryotic only Requires RIN greater than 9 Full length cDNA, requires sonication or treat with Nextera (never tested) Reagents have short shelf life ~6 months

smRNA 1-10ug total RNA, RIN greater than 9 Only 12 barcodes in stock Requires addition size selection

Pippin Prep Software does not consistently call ladder. Yeild ~50% Size selection +- 40bp

Metagenomics/16s Sequencing Metagenomics is an emerging field Genomic analysis is applied to microbial communities rather than individual microbes Bypasses the need to isolate and culture individual microbial species Many microbes are resistant to culturing Has potential medical uses.

16s Two PCR steps used to create V4 specific sequence capable libraries. Dual Barcodes – 1 st read 5’ barcode. 2 nd read 3’ barcode V1 V2 V3 V4 V5 V6 V7

Offset Primers High base conservation upstream and downstream of V4 region Designed primers to offset sequence to improve base balance

TBARCODETGCCAGC TBARCODEATGCCAG TBARCODETCTGCCA TBARCODECAATGCC Upstream – Read 1 Downstream – Read 2 CGATCTGGACTAHVG CGATCTAGGACTAHV CGATCTCAGGACTAH CGATCTTCTGGACTA

To Do Optimize RiboZero to reduce rRNA contamination Test ability to use Nextera instead of covartis fragmentation for clontech samples Run 16s offset samples to check base balance