Chapter 12: DNA-protein interactions

Preparation of nuclear extracts and cytoplasmic (S-100) fraction Use hypotonic solutions and 10 up-and-down strokes with a glass Dounce homogenizer. Check for cell lysis under a microscope and trypan blue exclusion. Centrifuge to separate the supernatant and the nuclei fraction. The nuclei fraction first in low-salt buffer, then in high salt- buffer. Dounce and centrifuge to obtain the nuclear extract.. Centrifuge the supernatant at 100,000 x g for 1 hr. The supernatant is the S-100 fraction. Dialyze 4. and 5, until the conductivities within and outside the dialysis bag are equal. Aliquot, rapidly freeze in liquid nitrogen, and store at C.

Mobility shift assay Use 4% or 5% non-denaturing acrylamide gel and TAE or TBE buffer. Labeled DNA of bp as probes. Pre-run the gel, min at 100V Mix: DNA probe DNA-binding proteins (purified proteins or crude extract) BSA Glycerol Carrier DNA, eg., poly(dI-dC).poly(dI-dC) Incubate min, at o C. Load on gel and electrophoresis. Autoradiopgraphy.

Competition mobility shift assay In the binding reactions, In addition to the labeled DNA probe, add increasing amounts of unlabelled specific and non-specific competitor DNAs. Add DNA-binding protein last.

Antibody supershift assay In 2 tubes of binding reactions, In addition to the labeled DNA probe, add specific antibody to 1 tube, and add nonspecific control antibody to the other tube.

Multicomponent mobility shift assay Proteins B and C will bind to the protein A-DNA complex. Need to saturate probe with protein A to reach a concentration where the ABC complex can form.

Purification of DNA-binding proteins using biotin/ streptavidin affinity systems. (Biotin form tight and irreversible complex with streptavidin.) Labeled a DNA fragment with biotin-11-dUTP, one isotopic dNTP, and the other 2 unlabelled dNTPs by klenow. Set up binding reaction with DNA-binding proteins. Add streptavidin, incubate at 30 0 C for 5 min. Transfer the binding reaction to an eppendorf tube containing biotin-cellulose resin (Pierce) or streptavidin- agarose beads. Incubate. Wash the pellet. Resuspend the pellet in elution buffer. Centrifuge, and save the supernatant. Assay for binding activity.

Purification of oligonucleotides by preparative gel electrophoresis Prepare 16% polyacylamide/urea gel for separating base oligonucleotides. Pre-run at 30 W for >1 hr. Dissolve DNA in formamide loading buffer. Heat 15 min at 65 0 C to remove 2 0 structure, and load on gel. 30 W for ～ 4 hr until bromphenol blue move to 75% of the gel. (With 16% polyacylamide/urea gel, bromphenol blue comigrate with ～ 10-base oligonucleotides, and cylene cyanol ～ 30-base oligonucleotides.) Transfer the gel to a Saran wrap, and cut the DNA band under a short-wavelength UV lamp. Add TE, shaking for overnight at 37 0 C. Filter through a pipet with a glass wool plug. Extract DNA with sec-butanol, diethyl ether, and evaporate. Dissolve in TE, and ethanol precipitation. Dissolve in TE, measure OD 260, and store at C. For sequence-specific DNA affinity column, assume 1OD = 40 μ g/ml DNA.

Purification of DNA-binding proteins by affinity chromatography I.Preparation of DNA affinity resin. II.DNA affinity chromatography.

I. Preparation of DNA affinity resin 1. Mix 2 complementary HPLC- or gel-purified oligonucleotides, T4 polynucleotide kinase, and γ- 32 PATP. Incubate. 2. Inactivate T4 polynucleotide kinase by adding ammonium acetate. Heat at 65 0 C for 15 min and cool to rt (annealing). 3. Ethanol precipitate, dissolve in TE 4. Phenol extraction and ethanol precipitation 5. Ligate to multimers, store at C. 6. Wash Sepharose CL-2B (GE) with water with a glass funnel. Transfer to hood, and keep slow stirring. 7. Dissolve CNBr (Aldrich) with N,N-dimethylformamide in hood. 8. Add 7. to 6. within 1 min dropwise. 9. Every 10 sec add 30 μl 5 N NaOH for 10 min, until 1.8 ml NaOH has been added.

10. Add ice-cold water. 11. Wash the resin with ice-cold water, 2X, and 10 mM potassium phosphate, 2X, with a glass funnel. 12. Add 4 ml of 10 mM potassium phosphate. 13. Add DNA, incubate at rt for overnight on a rotating wheel. 14. Transfer to hood, wash with water 2X, and 1 M ethanolamide hydrochloride, 1X. 15. Add 1M ethanolamide hydrochloride, incubate at rt for 2-4 hr on a rotating wheel. 16. Wash the resin with 10 mM potassium phosphate, 1 M potassium phosphate, 1 M KCl, water, and then, column storage buffer Store at 4 0 C. Resins are stable at least 1 year.

II. DNA affinity chromatography 1. Equilibrate 1 ml DNA affinity resin in a chromatography column with 10 ml of buffer Z/0.1 M KCl, 2X. (Buffer Z: HEPES, MgCl 2, DTT, 20% glycerol, 0.1% NP-40, pH 7.6.) 2. Combine protein solution in wash buffer Z/0.1 M KCl with non-specific competitor DNA, incubate 10 min on ice. 3. Centrifuge and discard the insoluble DNA-protein complexes. 4. Load onto the column at gravity flow. 5. Wash with 2 ml wash buffer Z/0.1 M KCl, 4X (not 8 ml, 1X). 6. Elute with 1ml of buffer Z/0.2 M KCl, buffer Z/0.3 M KCl, buffer Z/0.4 M KCl, buffer Z/0.5 M KCl, buffer Z/0.6 M KCl, buffer Z/0.7 M KCl, buffer Z/0.8 M KCl, buffer Z/0.9 M KCl, buffer Z/1 M KCl, successively. Collect 1 ml fractions corresponding to the addition of 1 ml portions of buffer. Freeze in liquid nitrogen and store at C. 7. Regenerate the affinity resins with regeneration buffer (Tris, EDTA, 2.5 M NaCl, 1% NP-40), and wash with storage buffer (Tris, EDTA, 0.3 M NaCl, 0.04% (w/v) sodium azide). Store at 4 0 C.

Determination of protein-DNA sequence specificity by PCR- assisted binding site selection 1. Random-sequence oligonucleotides R76 5’- CAGGTCAGTTCAGCGGATCCTGTCG(A/C/G/T)26GAGGC GAATTCAGTGCAACTGCAGC-3’ Primer F: 5’-GCTGCAGTTGCACTGAATTCGCCTC-3’ R: 5’- CAGGTCAGTTCAGCGGATCCTGTCG-3’ 2. Gel-purified primers R76, F, and R. 3. In an eppendorf tube, add R76, F, 3 dNTP (0.5 mM each), dCTP (40 μM), α 32 PdCTP, Taq polymerase. 4. One cycle for 94 0 C, 1 min; 62 0 C, 3 min; 72 0 C, 9 min. 5. Chase extension by adding 0.5 mM dCTP, 72 0 C, 9 min.

6. Purify dsR76 on 8% non-denaturing PAGE. 7. Rehydrate and wash protein A-Sepharose CL-4B beads in water. 8. Wash with wash buffer containing 50 μg/ml BSA. 9. Add binding buffer containing 50 μg/ml BSA. Poly (dI-dC).poly(dI-dC) protein sample dsR76 antiserum min on ice (to form protein-DNA complex). 11. Transfer protein A-sepharose (step 7.) to an eppendorf tube containing wash buffer without BSA. 12. Centrifuge, discard supernatant. 13. Add binding reaction (step 9), mix C overnight on a rotating wheel. 15. Wash with binding buffer without BSA, 2X. 16. Elute DNA from beads by adding recovery buffer and incubate at 45 0 C for 1 hr.

17. Phenol extraction 18. Add glycogen carrier, and ethanol precipitation. 19. Measure pellet for Cerenkov counts on a scintillation counter. 20. Add 1 pg DNA (step 18.), R, F, 3 dNTP (0.5 mM each), dCTP (40 μM), α 32 PdCTP, Taq polymerase. 21. PCR, 15 cycles : 94 0 C, 1 min; 62 0 C, 1 min; 72 0 C, 1 min. 22. Phenol extraction 23. Add glycogen carrier, ethanol precipitation. 24. Gel-purified DNA. 25. Repeat 4 cycles of binding-site selection (step 9 to 24), save DNAs from each selection.

26. Perform binding assay (step 9 lacking antiserum, and step 10) with DNAs of each selection cycles. 27. Mobility shift assay. If the selections have been successful, complexes appear with DNAs of later selections.

Isolation of bound oligonucleotides from mobility shift gels Cut out the gel Add with the DNA-protein complex. Add R, F, 3 dNTP (0.5 mM each), dCTP (40 μM), α 32 PdCTP, Taq polymerase PCR, 17 cycles: 94 0 C, 1 min; 62 0 C, 1 min; 72 0 C, 1 min. Check and purify PCR products EcoRI and BamHI double digestion. Phenol extraction and ethanol precipitation, and cloning. Colonies might be slightly radioactive.

Chapter 15: The polymerase Chain reaction

Standard procedures and optimization of PCR First check 0 mM, 1.5 mM, 3.0 mM, and 4.5 mM MgCl 2, and best enhancer for PCR, using undiluted DNA as template. PCR condition: 30 cycles; 94 0 C, 30 sec; 55 0 C (GC 50%), 30 sec; 72 0 C, 1 min/ kb. (For the last cycle, extension can be 7 min.) Take one tenth for electrophoresis. Choose the best condition, then check amounts of template DNA, preparation temperature (rt or 4 0 C), and hot start. Use the same PCR condition but adding 94 0 C, 5 min before PCR.

Ligation-mediated PCR (single site PCR, anchored PCR) Digest genomic DNA, add linker, and PCR.

Generation of T-vectors for cloning of PCR products.