CS273a Lecture 4, Autumn 08, Batzoglou Hierarchical Sequencing

CS273a Lecture 4, Autumn 08, Batzoglou Hierarchical Sequencing Strategy 1.Obtain a large collection of BAC clones 2.Map them onto the genome (Physical Mapping) 3.Select a minimum tiling path 4.Sequence each clone in the path with shotgun 5.Assemble 6.Put everything together a BAC clone map genome

CS273a Lecture 4, Autumn 08, Batzoglou Hierarchical Sequencing Strategy 1.Obtain a large collection of BAC clones 2.Map them onto the genome (Physical Mapping) 3.Select a minimum tiling path 4.Sequence each clone in the path with shotgun 5.Assemble 6.Put everything together a BAC clone map genome

CS273a Lecture 4, Autumn 08, Batzoglou Methods of physical mapping Goal: Make a map of the locations of each clone relative to one another Use the map to select a minimal set of clones to sequence Methods: Hybridization Digestion

CS273a Lecture 4, Autumn 08, Batzoglou 1. Hybridization Short words, the probes, attach to complementary words 1.Construct many probes 2.Treat each BAC with all probes 3.Record which ones attach to it 4.Same words attaching to BACS X, Y  overlap p1p1 pnpn

CS273a Lecture 4, Autumn 08, Batzoglou 2.Digestion Restriction enzymes cut DNA where specific words appear 1.Cut each clone separately with an enzyme 2.Run fragments on a gel and measure length 3.Clones C a, C b have fragments of length { l i, l j, l k }  overlap Double digestion: Cut with enzyme A, enzyme B, then enzymes A + B

CS273a Lecture 4, Autumn 08, Batzoglou Online Clone-by-clone The Walking Method

CS273a Lecture 4, Autumn 08, Batzoglou The Walking Method 1.Build a very redundant library of BACs with sequenced clone- ends (cheap to build) 2.Sequence some “seed” clones 3.“Walk” from seeds using clone-ends to pick library clones that extend left & right

CS273a Lecture 4, Autumn 08, Batzoglou Walking: An Example

CS273a Lecture 4, Autumn 08, Batzoglou Some Terminology insert a fragment that was incorporated in a circular genome, and can be copied (cloned) vector the circular genome (host) that incorporated the fragment BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length kb read a long word that comes out of a sequencing machine coverage the average number of reads (or inserts) that cover a position in the target DNA piece shotgun the process of obtaining many reads sequencing from random locations in DNA, to detect overlaps and assemble

CS273a Lecture 4, Autumn 08, Batzoglou Whole Genome Shotgun Sequencing cut many times at random genome forward-reverse paired reads plasmids (2 – 10 Kbp) cosmids (40 Kbp) known dist ~800 bp

CS273a Lecture 4, Autumn 08, Batzoglou Fragment Assembly (in whole-genome shotgun sequencing)

CS273a Lecture 4, Autumn 08, Batzoglou Fragment Assembly Given N reads… Where N ~ 30 million… We need to use a linear-time algorithm

CS273a Lecture 4, Autumn 08, Batzoglou Steps to Assemble a Genome 1. Find overlapping reads 4. Derive consensus sequence..ACGATTACAATAGGTT.. 2. Merge some “good” pairs of reads into longer contigs 3. Link contigs to form supercontigs Some Terminology read a long word that comes out of sequencer mate pair a pair of reads from two ends of the same insert fragment contig a contiguous sequence formed by several overlapping reads with no gaps supercontig an ordered and oriented set (scaffold) of contigs, usually by mate pairs consensus sequence derived from the sequene multiple alignment of reads in a contig

CS273a Lecture 4, Autumn 08, Batzoglou 1. Find Overlapping Reads aaactgcagtacggatct aaactgcag aactgcagt … gtacggatct tacggatct gggcccaaactgcagtac gggcccaaa ggcccaaac … actgcagta ctgcagtac gtacggatctactacaca gtacggatc tacggatct … ctactacac tactacaca (read, pos., word, orient.) aaactgcag aactgcagt actgcagta … gtacggatc tacggatct gggcccaaa ggcccaaac gcccaaact … actgcagta ctgcagtac gtacggatc tacggatct acggatcta … ctactacac tactacaca (word, read, orient., pos.) aaactgcag aactgcagt acggatcta actgcagta cccaaactg cggatctac ctactacac ctgcagtac gcccaaact ggcccaaac gggcccaaa gtacggatc tacggatct tactacaca

CS273a Lecture 4, Autumn 08, Batzoglou 1. Find Overlapping Reads Find pairs of reads sharing a k-mer, k ~ 24 Extend to full alignment – throw away if not >98% similar TAGATTACACAGATTAC ||||||||||||||||| T GA TAGA | || TACA TAGT || Caveat: repeats  A k-mer that occurs N times, causes O(N 2 ) read/read comparisons  ALU k-mers could cause up to 1,000,000 2 comparisons Solution:  Discard all k-mers that occur “ too often ” Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available

CS273a Lecture 4, Autumn 08, Batzoglou 1. Find Overlapping Reads Create local multiple alignments from the overlapping reads TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA

CS273a Lecture 4, Autumn 08, Batzoglou 1. Find Overlapping Reads Correct errors using multiple alignment TAGATTACACAGATTACTGA TAGATTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTACTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA insert A replace T with C correlated errors— probably caused by repeats  disentangle overlaps TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTATTGA In practice, error correction removes up to 98% of the errors

CS273a Lecture 4, Autumn 08, Batzoglou 2. Merge Reads into Contigs Overlap graph:  Nodes: reads r 1 …..r n  Edges: overlaps (r i, r j, shift, orientation, score) Note: of course, we don’t know the “color” of these nodes Reads that come from two regions of the genome (blue and red) that contain the same repeat