The individual compartments have different functions due to the unique profile of proteins in these compartments. How do the proteins reach their correct.

Slides:



Advertisements
Similar presentations
Lesson 3: Translation.
Advertisements

Golgi complex László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology Semmelweis University 2008.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Cell Structure and Function Chapter 3 Basic Characteristics of Cells Smallest living subdivision of the human body Diverse in structure and function.
PROTEIN TRAFFICKING AND LOCALIZATION PROTEINS SYNTHESIZED IN CYTOPLASM, BUT BECOME LOCALIZED IN CYTOPLASM CYTOPLASMIC MEMBRANE PERIPLASM OUTER MEMBRANE.
Translation Translation is the process of building a protein from the mRNA transcript. The protein is built as transfer RNA (tRNA) bring amino acids (AA),
Lecture 18: Intracellular transport Flint et al., Chapter 12.
RNA Polymerase binding *Constitutive or basal level transcription.
Endomembranes & Protein Trafficking Chapter 8 Part 1.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Chemical reactions in cells need to be isolated. Enzymes work in complexes, spatial distribution in cytosol, nucleus Confinement of reactions in organelle.
Lecture 7 - Intracellular compartments and transport II
Inside the Cell 7.1 What’s Inside the Cell? Prokaryotic Cells Eukaryotic Cells –The Nucleus –Ribosomes –Rough Endoplasmic Reticulum –Golgi Apparatus –Smooth.
Nucleic Acids 7.3 Translation.
Protein synthesis decodes the information in messenger RNA
The Secretory Pathway - Classic Experiments - ER Translocation - Membrane budding and fusion.
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Cell Biology Course Info and Introduction. What is Cell Biology? Investigation of Biological Systems –Biochemistry –Molecular Biology –Genetics/Molecular.
1 CA García Sepúlveda MD PhD Protein Localization, Translocation & Trafficking Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad.
Plant hormone signaling I 1.What is a plant hormone? How to determine if a molecule functions as a hormone or not? Several criteria: 1) produced by plant.
CHAPTER 6 SYSTEMS BIOLOGY OF CELL ORGANIZATION
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
Chapter 3 Membrane targeting of proteins By D. Thomas Rutkowski & Vishwanath R. Lingappa.
Protein targeting to organelles 1.From the birth place to the destination— general principles 1)The problem: One place to make protein but many destinations—how.
Cellular compartmentalization Pages Q1 Name at least two of the three protein complexes involved in the electron transport chain?
Molecular and Cellular Biochemistry 2. ER- protein modifications
Transcription DNA  mRNA. Review What was the purpose for DNA replication? What was the purpose for DNA replication? So cell division (mitosis & meiosis)
THE IMPORTANCE OF LABELLING YOUR S(TUFF) In the Globe and Mail this weekend there was a little anecdote that went as follows: PhD student spends three.
© 2003 By Default!Slide 1 Protein Sorting, Transport and modification part1 M. Saifur Rohman, MD, PhD, FIHA.
Golgi complex BIOLOGY, Faculty of Medicine and Dentistry László KŐHIDAI, PhD., Assoc. Prof. Department of Genetics, Cell- and Immunobiology.
Golgi Apparatus By: Kousha Zamanipour 306. What is The Golgi Apparatus?  The golgi apparatus can also be referred to as “the post office” of the cell.
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 13 Moving Proteins into Membranes.
Fates of Proteins in Cells See also pages in Goodman.
1. 2 Permission Template (mRNA) Building blocks (20 types of aa) Ribosome tRNA Enzymes Energy (ATP & GTP) Protein factors What are needed for translation.
LECT 20: PROTEIN SYNTHESIS AND TRANSLATIONAL CONTROL High fidelity of protein synthesis from mRNA is essential. Mechanisms controling translation accuracy.
Cell structure and function-protein synthesis. What is protein synthesis? Messenger RNA from the cell nucleus is moved systemically along the ribosome.
REVIEW CELL STRUCTURES. Flow of Genetic Information in the Cell: DNA → RNA → Protein (Chapters 5–7) Movement Across Cell Membranes (Chapter 7) Energy.
Javad Jamshidi Fasa University of Medical Sciences, October 2015 Eukaryotic Cell Organelles and Organization.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
Ch. 3 Cell Organization. Cells and Tissues Carry out all chemical activities needed to sustain life Cells are the building blocks of all living things.
Pg. 367.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
Getting things where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain Role of tRNA, base pairing and.
Announcements Textbook: Notice “Key Concepts”. Test the endosymbiosis hypothesis… 1. What evidence could you look for? 2. Design an experiment: PCR, scope,
Vesicular Trafficking Movement From the ER Through the Golgi.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
Protein targeting or Protein sorting Refer Page 1068 to 1074 Principles of Biochemistry by Lehninger & Page 663 Baltimore Mol Cell Biology.
The Signal Hypothesis and the Targeting of Nascent Polypeptides to the Secretory Pathway Tuesday 9/ Mike Mueckler
Why organelles? Specialized structures specialized functions cilia or flagella for locomotion Containers partition cell into compartments create different.
Protein Synthesis and Sorting: A Molecular View
The Nobel Prize in Physiology or Medicine 1999
Protein Sorting & Transport
Amino acids (protein building blocks) are coded for by mRNA base sequences.
Protein Synthesis How does DNA control all activities
The making of proteins for …..
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
Protein Transport Molecular Cell
Intracellular Compartments and Transport
#24 The Role of Ribosomes, Golgi Apparatus and Endoplasmic Reticulum in the Production, Storage and Secretion of Proteins. Cell Biology Standard 1E. The.
ROUGH E.R By:ISAIAH HAIRSTON.
Chapter 7 Inside the Cell Biological Science, Third Edition
Chapter 2 - Cellular activity
Volume 57, Issue 3, Pages (March 2000)
Presentation transcript:

The individual compartments have different functions due to the unique profile of proteins in these compartments. How do the proteins reach their correct destinations? Where is the information for destination stored? How is this information read? What are the trafficking patterns?

Cellular addresses of proteins reside in the primary and secondary structure Cellular sentinels recognize these addresses by direct interaction.

1.Label nascent proteins with radioactive a.a. 2.Homogenize  vesicles 3.Digest +/- detergent 4.SDS PAGE Co-translation Prove it!

Secretory proteins move from the rough ER lumen through the Golgi and then to the cell surface. 1.Transport vesicles 2.Cisternal progression 3.TGN 4.Regulated and constitutive secretion 5.Lysozomes

Many of the molecules involved in this process were obtained either via genetic or biochemical approaches. But, before that, the pathway had to be discovered and carefully characterized. George Palade got the prize for doing this! see Classic Expt Pulse-chase using acinar cells.

Read Classic Experiment 17.1 TS invertase mutants do not secrete invertase at the nonpermissive temperature. Pulse chase experiments were used to identify were secretion was blocked. Analysis of such mutants revealed 5 classes. Cloned genes indicated molecular components of the secretory pathway

Translocation of secretory proteins across the ER Signal Sequence Microsomes required Signal sequence cleaved Signal peptidase in lumen SS= charge/hydrophob/charged ca. 70 amino acids from add-in A few are different (alpha factor) This expt. enabled discovery of factors such as the SRP

40 30 (1)300-bp RNA plus (6) subunits SRP relieves stall

Chem.-modified lysyl tRNA

Orientation of membrane proteins is established during co-translation.