Функции Введение А.Б.Рахманинова (13-14 марта 2007г.)

Slides:



Advertisements
Similar presentations
Annotation of Gene Function …and how thats useful to you.
Advertisements

Applications of GO. Goals of Gene Ontology Project.
Three Fates of Pyruvate Pyruvate  acetyl-CoA Occurs in mitochondria Produce CO 2 and NADH + H + Pyruvate Dehydrogenase Aerobic **Acetyl-CoA used in the.
Annotating Gene Products to the GO Harold J Drabkin Senior Scientific Curator The Jackson Laboratory Mouse.
Gene Ontology John Pinney
Gene function analysis Stem Cell Network Microarray Course, Unit 5 May 2007.
Функции II. Классификация. Зачем? А.Б.Рахманинова (6 марта 2006 г.)
Prentice Hall c2002Chapter 121 Chapter 12 - The Citric Acid Cycle The citric acid cycle is involved in the aerobic catabolism of carbohydrates, lipids.
COG and GO tutorial.
1 The Citric Acid Cycle (Tricarboxylic Acid Cyle) 1. The link between gycolysis and citric acid cycle 2. TCA cycle oxidizes 2 –C units 3. Entry and metabolism.
Gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta.
Swiss-Prot – одна из первых баз данных белковых последовательностей, “gold standard” белковой аннотации. Аннотация выполнена вручную группой профессиональных.
Gtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta.
BI class 2010 Gene Ontology Overview and Perspective.
Chemistry: An Introduction to General, Organic, and Biological Chemistry, Eleventh Edition Copyright © 2012 by Pearson Education, Inc. Chapter 18 Metabolic.
Oxidative Decarboxylation of pyruvate and TCA cycle
BRIDGING REACTION STEP 2 Fall 2013 BIOT 309. TRANSITION OR BRIDGING REACTION Connects glycolysis to citric acid/Kreb’s Cycle OVERALL REACTION 2 pyruvate.
Metabolism and Energy Production
PAT project Advanced bioinformatics tools for analyzing the Arabidopsis genome Proteins of Arabidopsis thaliana (PAT) & Gene Ontology (GO) Hongyu Zhang,
SPH 247 Statistical Analysis of Laboratory Data 1 May 12, 2015 SPH 247 Statistical Analysis of Laboratory Data.
Using The Gene Ontology: Gene Product Annotation.
Annotating Gene Products to the GO Harold J Drabkin Senior Scientific Curator The Jackson Laboratory Mouse.
Cellular Metabolism Part 4 - Cell Physiology. Lecture Outline Energy Systems & Flow Metabolism Basics Cellular Respiration –Glycolysis –Citric Acid Cycle.
The tricarboxylic acid (TCA) cycle Biochemistry, 4 th edition, RH Garrett & CM Grisham, Brooks/Cole (Cengage); Boston, MA: 2010 pp Instructor:
SPH 247 Statistical Analysis of Laboratory Data 1May 14, 2013SPH 247 Statistical Analysis of Laboratory Data.
CITRIC ACID CYCLE- discovered by Sir Hans Krebs in He was awarded Nobel Prize in Medicine Sir Hans KrebsSir Hans Krebs 1. The citric acid cycle (also.
The Krebs Cycle (Citric Acid Cycle) By Zuzana Kollarova.
Glycolysis 1. From glucose to pyruvate; step reactions; 3
3 parts of Respiration Glycolysis – may be anaerobic
Cellular Respiration Part 3
BIOINFORMATIK I UEBUNG 2 mRNA processing.
Monday, November 8, 2:30:07 PM  Ontology is the philosophical study of the nature of being, existence or reality as such, as well as the basic categories.
From Functional Genomics to Physiological Model: Using the Gene Ontology Fiona McCarthy, Shane Burgess, Susan Bridges The AgBase Databases, Institute of.
Manual GO annotation Evidence: Source AnnotationsProteins IEA:Total Manual: Total
Introduction to the GO: a user’s guide Iowa State Workshop 11 June 2009.
SRI International Bioinformatics 1 Submitting pathway to MetaCyc Ron Caspi.
24th Feb 2006 Jane Lomax GO Further. 24th Feb 2006 Jane Lomax GO annotations Where do the links between genes and GO terms come from?
Gene Product Annotation using the GO ml Harold J Drabkin Senior Scientific Curator The Jackson Laboratory.
Alastair Kerr, Ph.D. WTCCB Bioinformatics Core An introduction to DNA and Protein Sequence Databases.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Concept 9.3: The citric acid cycle completes the energy-yielding oxidation of.
The Meat and Potatoes of Cellular Respiration
Getting Started: a user’s guide to the GO GO Workshop 3-6 August 2010.
Functional Annotation and Functional Enrichment. Annotation Structural Annotation – defining the boundaries of features of interest (coding regions, regulatory.
1 Gene function annotation. 2 Outline  Functional annotation  Controlled vocabularies  Functional annotation at TAIR  Resources and tools at TAIR.
Other biological databases and ontologies. Biological systems Taxonomic data Literature Protein folding and 3D structure Small molecules Pathways and.
Getting Started: a user’s guide to the GO TAMU GO Workshop 17 May 2010.
A Common Language for Annotation of Genes from Yeast, Flies and Mice The Gene Ontologies …and Plants and Worms …and Humans …and anything else!
Rice Proteins Data acquisition Curation Resources Development and integration of controlled vocabulary Gene Ontology Trait Ontology Plant Ontology
Introduction to the GO: a user’s guide NCSU GO Workshop 29 October 2009.
Update Susan Bridges, Fiona McCarthy, Shane Burgess NRI
1 Annotation EPP 245/298 Statistical Analysis of Laboratory Data.
Draw a reaction map of glucose completely metabolized to CO 2 + H 2 O in the presence of oxygen25 Points Reference:
Aerobic Respiration Section 9:2. Overview Krebs Cycle: In the presence of O2, Pyruvic Acid oxidizes, the reduction of NAD + to NADH, and FAD to FADH,
The Citric Acid Cycle.
Oxidative Decarboxylation of pyruvate and TCA cycle
Chapter 23 Metabolism and Energy Production
Gene Annotation & Gene Ontology
Annotating with GO: an overview
School of Sciences, Lautoka Campus BIO509 Lecture 27: Respiration
Biochemistry department
Introduction to the Gene Ontology
NOTES: Chapter 9 (Part 2): Glycolysis & Krebs Cycle (9.2 & 9.3)
Krebs Cycle Tricarboxylic Acid Cycle
Pyruvate Oxidation and the Citric Acid Cycle
Harvesting Energy from Organic Molecules
Gene expression analysis
Cellular Respiration Part III:
Insight into GO and GOA Angelica Tulipano , INFN Bari CNR
Aerobic Respiration Section 9:2.
Aerobic Respiration: Overview
Presentation transcript:

Функции Введение А.Б.Рахманинова (13-14 марта 2007г.)

gcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgactta ggtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattacca acggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtgcgggctttttttttcgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcggca catcagtggcaaatgcagaacgttttctgcgtgttgccgatattctggaaagcaatgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacctgg cgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgccgaacgtatttttgccgaacttttgacgggactcgccgccgcccagccggggttcccgctgg aattgaaaactttcgtcgatcaggaatttgcccaaataaaacatgtcctgcatggcattagtttgttggggcagtgcccggatagcatcaacgctgcgctgatttgccgtggcgaga tgtcgatcgccattatggccggcgtattagaagcgcgcggtcacaacgttactgttatcgatccggtcgaaaaactgctggcagtggggcattacctcgaatctaccgtcgatattg agtccacccgccgtattgcggcaagccgcattccggctgatcacatggtgctgatggcaggtttcaccgccggtaatgaaaaaggcgaactggtggtgcttggacgcaacggttccg actctgctgcggtgctggctgcctgtttacgcgccgattgttgcgagatttggacggacgttgacggggtctatacctgcgacccgcgtcaggtgcccgatgcgaggttgttgaagt tgtcctaccaggaagcgatggagctttcctacttcggcgctaaagttcttcacccccgcaccattacccccatcgcccagttccagatcccttgcctgattaaaaataccggaaatc aagcaccaggtacgctcattggtgccagccgtgatgaagacgaattaccggtcaagggcatttccaatctgaataacatggcaatgttcagcgtttctggtccggggatgaaaggga tcggcatggcggcgcgcgtctttgcagcgatgtcacgcgcccgtatttccgtggtgctgattacgcaatcatcttccgaatacagcatcagtttctgcgttccacaaagcgacttgc gagctgaacgggcaatgcaggaagagttctacctggaactgaaagaaggcttactggagccgctggcagtgacggaacggctggccattatctcggtggtaggtgatggtagcacct tgcgtgggatctcggcgaaattctttgccgcactggcccgcgccaatatcaacattgtcgccattgctcagggatcttctgaacgctcaatctctgtcgtggtaaataacgatgatg ccactggcgtgcgcgttactcatcagatgctgttcaataccgatcaggttatcgaagtgtttgtgattggcgtcggtggcgttggcggtgcgctgctggagcaactgaagcgtcagc gctggctgaagaataaacatatcgacttacgtgtctgcggtgttgccaactcgaaggctctgctcaccaatgtacatggccttaatctggaaaactggcaggaagaactggcgcaag aagagccgtttaatctcgggcgcttaattcgcctcgtgaaagaatatcatctgctgaacccggtcattgttgactgcacttccagccaggcagtggcggatcaatatgccgacttgc gcgaaggtttccacgttgtcacgccgaacaaaaaggccaacacctcgtcgatggattactaccatcagttgcgttatgcggcggaaaaatcgcggcgtaaattcctctatgacacca ttggggctggattaccggttattgagaacctgcaaaatctgctcaatgcaggtgatgaattgatgaagttctccggcattctttctggttcgctttcttatatcttcggcaagttag aaggcatgagtttctccgaggcgaccacgctggcgcgggaaatgggttataccgaaccggacccgcgagatgatctttctggtatggatgtggcgcgtaaactattgattctcgct aaacgggacgtgaactggagctggcggatattgaaattgaacctgtgctgcccgcagagtttaacgccgagggtgatgttgccgcttttatggcgaatctgtcacaactcgacgatc ttgccgcgcgcgtggcgaaggcccgtgatgaaggaaaagttttgcgctatgttggcaatattgatgaagatggcgtctgccgcgtgaagattgccgaagtggatggtaatgatccgc tcaaagtgaaaaatggcgaaaacgccctggccttctatagccactattatcagccgctgccgttggtactgcgcggatatggtgcgggcaatgacgttacagctgccggtgtctttg atctgctacgtaccctctcatggaagttaggagtctgacatggttaaagtttatgccccggcttccagtgccaatatgagcgtcgggtttgatgtgctcggggcggcggtgacacct gatggtgcattgctcggagatgtagtcacggttgaggcggcagagacattcagtctcaacaacctcggacgctttgccgataagctgccgtcagaaccacgggaaaatatcgtttat tgctgggagcgtttttgccaggaactgggtaagcaaattccagtggcgatgaccctggaaaagaatatgccgatcggttcgggcttaggctccagtgcctgttcggtggtcgcggcg atggcgatgaatgaacactgcggcaagccgcttaatgacactcgtttgctggctttgatgggcgagctggaaggccgtatctccggcagcattcattacgacaacgtggcaccgtgt ctcggtggtatgcagttgatgatcgaagaaaacgacatcatcagccagcaagtgccagggtttgatgagtggctgtgggtgctggcgtatccggggattaaagtctcgacggcagaa agggctattttaccggcgcagtatcgccgccaggattgcattgcgcacgggcgacatctggcaggcttcattcacgcctgctattcccgtcagcctgagcttgccgcgaagctgatg gatgttatcgctgaaccctaccgtgaacggttactgccaggcttccggcaggcgcggcaggcggtcgcggaaatcggcgcggtagcgagcggtatctccggctccggcccgaccttg gctctgtgtgacaagccggaaaccgcccagcgcgttgccgactggttgggtaagaactacctgcaaaatcaggaaggttttgttcatatttgccggctggatacggcgggcgcacga ctggaaaactaaatgaaactctacaatctgaaagatcacaacgagcaggtcagctttgcgcaagccgtaacccaggggttgggcaaaaatcaggggctgttttttccgcacgacctg gaattcagcctgactgaaattgatgagatgctgaagctggattttgtcacccgcagtgcgaagatcctctcggcgtttattggtgatgaaatcccacaggaaatcctggaagagcgc cgcgcggcgtttgccttcccggctccggtcgccaatgttgaaagcgatgtcggttgtctggaattgttccacgggccaacgctggcatttaaagatttcggcggtcgctttatggca atgctgacccatattgcgggtgataagccagtgaccattctgaccgcgacctccggtgataccggagcggcagtggctcatgctttctacggtttaccgaatgtgaaagtggttatc tatccacgaggcaaaatcagtccactgcaagaaaaactgttctgtacattgggcggcaatatcgaaactgttgccatcgacggcgatttcgatgcctgtcaggcgctggtgaagcag tttgatgatgaagaactgaaagtggcgctagggttaaactcggctaactcgattaacatcagccgtttgctggcgcagatttgctactactttgaagctgttgcgcagctgccgca acgcgcaaccagctggttgtctcggtgccaagcggaaacttcggcgatttgacggcgggtctgctggcgaagtcactcggtctgccggtgaaacgttttattgctgcgaccaacgtg gataccgtgccacgtttcctgcacgacggtcagtggtcacccaaagcgactcaggcgacgttatccaacgcgatggacgtgagtcagccgaacaactggccgcgtgtggaagagttg cgccgcaaaatctggcaactgaaagagctgggttatgcagccgtggatgatgaaaccacgcaacagacaatgcgtgagttaaaagaactgggctacacttcggagccgcacgctgta gcttatcgtgcgctgcgtgatcagttgaatccaggcgaatatggcttgttcctcggcaccgcgcatccggcgaaatttaaagagagcgtggaagcgattctcggtgaaacgttggat ccaaaagagctggcagaacgtgctgatttacccttgctttcacataatctgcccgccgattttgctgcgttgcgtaaattgatgatgaatcatcagtaaaatctattcattatctca aggccgggtttgcttttatgcagcccggcttttttatgaagaaattatggagaaaaatgacagggaaaaaggagaaattctcaataaatgcggtaacttagagattaggattgcgga taacaaccgccgttctcatcgagtaatctccggatatcgacccataacgggcaatgataaaaggagtaacctgtgaaaaagatgcaatctatcgtactcgcactttccctggttctg gctcccatggcagcacaggctgcggaaattacgttagtcccgtcagtaaaattacagataggcgatcgtgataatcgtggctattactgggatggaggtcactggcgcgaccacggc Давайте помнить цель Мы хотим знать, что закодировано в геномах, как это работает, каким образом это возникло…

13 марта 2007 EMBL Number of entries ─ 87,828,930 TrEMBL Number of entries─ Swiss-Prot Number of entries ─

Как узнают функцию белка или гена? Эксперимент – прямой и генетический ждите спецкурсов и практикумов Компьютерная аннотация — задача поиска ортологов, ….. ждите лекции М.С.Гельфанда поиск гомологов Сообщение хотите верьте, хотите нет

A Summary of the E. coli Chromosome (Gene Type Distribution), data from Updated January 26th, 2006 Updated February 1st, 2007

Основные биоинформатические базы данных  Основные БД последовательностей: EMBL, GeneBank, UniProt, SwissProt. Производные PFAM,PROSITE, INTERPRO, dbEST, dbSNP…….  БД 3D-структур: PDB. Производные SCOP, CATH, RNABase…..  БД и энциклопедии, в которых подробно описаны функции генов и их продуктов : KEGG, BIOCYC, ENZYME, TC-DB, REACTOME…….  Онтологии : GO, OBO, HUGO......

Функции I. Онтологии А.Б.Рахманинова (13 марта 2007г.)

Функции каких объектов?

Как понимать «гены и их продукты» ГенГен альтернативный сплайсинг у эукариот mRNA Белок 1 Зрелые rRNA и tRNA mRNA Белок 2 Белок 3 mRNA Активны й процессинг+модификация фермент Белок Процессинг и/или РТМ

Сколько записей в SWISS-Prot ?

Малатдегидрогеназа, EC (S)-malate + NAD + = oxaloacetate + NADH + H + Цикл Кребса Гликонеогенез MDHC_YEAST в цитоплазме DHM_YEAST в матриксе митохондрий MDHP_YEAST в пероксисомах Глиоксилатный путь Зачем дрожжам 3 фермента с ID  43-50% ??

Что такое "Функция"? ( что хочется знать о функции молекулярной машины) Где? Локализация (место в организме, клетке, комплексе) Зачем? Предназначение, роль в организме (клетке) Как? Тип молекулярного механизма С чем? Тип рабочего тела (специфичность)

Например, LacY_Ecoli Клеточная мембрана Транспорт сахаров в бактериальную клетку Симпорт H + /сахар Лактозный транспортер LDH_Ecoli Цитоплазма Анаэробный гликолиз Оксидоредуктаза, донор – группа –CH-OH, акцептор – НАД+ D-Лактатдегидрогеназа

1.Один белок и много функций цитохром с окислительное фосфорилирование индукция апоптоза 2.Одна функция и много белков 2.1. Ортологичный ряд алькогольдегидрогеназ 2.2. Аналогичные ферменты. Функция — не физический объект, не ген и не белок TRPC_ECOLI ЕС ЕС

Где искать описание функции Краткое описание функций одного белка и ссылки на другие ресурсы см. Краткое описание функций семейств белков и доменов см. в и Подробное описание функций генов и их продуктов см в энциклопедиях, таких как или Подробное описание отдельных классов функций и соответствующих белков см. в специализированных БД, таких как ENZYME,,...

Самая простая, но обычная проблема 2-фосфо-D-глицерат фосфоенолпируват + H 2 O 1.Сколько разных функций? phosphopyruvate hydratase, 2-phosphoglycerate dehydratase, enolase 2. Как найти то, что непонятно, как называется ? tricarboxylic acid cycle=TCA cycle=Krebs cycle=Citrate cycle=citric acid cycle BioCyc знает «TCA cycle» и «tricarboxylic acid cycle» KEGG понимает «Citrate cycle» и «TCA cycle» и «Reductive carboxylate cycle». -=- Гемоглобин есть в BioCyc и KEGG, но обе базы не понимают “oxygen transport”

Цели GO (Gene Ontology ) Создание концепции классификации наших биологических знаний о Молекулярных функциях (Function) (Как? С чем?) Например, carbohydrate binding или ATPase activity Биологических процессах (Process) (Зачем?) Например, митоз или биосинтез пуринов Клеточных компонентах (Component) (Где?) Например, ядро или холофермент РНК-полимераза II Создание общего языка, применимого для всех организмов. Создание формальной терминологии для аннотации генов и сравнении информации о разных видах.

Что такое GO ? 1.3 независимых словаря терминов 1.Molecular Function (Как? С чем?) 2.Biological Process (Зачем?) 3.Cellular Component (Где?) 2.Термины имеют определение и перечень синонимов. 3.Термины в пределах одной онтологии связаны отношениями "_is_a", "_is_part_of" или "has part_of" 4.Термины имеют стандартные идентификаторы.

tricarboxylic acid cycle Accession: GO: Ontology: biological_process Synonyms: exact: citric acid cycle exact: Krebs cycle exact: TCA cycle Definition: A nearly universal metabolic pathway in which the acetyl group of acetyl coenzyme A is effectively oxidized to two C02 and four pairs of electrons are transferred to coenzymes. The acetyl group combines with oxaloacetate to form citrate, which undergoes successive transformations to isocitrate, 2-oxoglutarate, succinyl-CoA, succinate, fumarate, malate, and oxaloacetate again, thus completing the cycle. In eukaryotes the tricarboxylic acid is confined to the mitochondria. See also glyoxylate cycle.

Аннотация GO для HBB_HUMAN (UniProt) 1.Ген или продукт ассоцируется из одним или несколькими терминами из всех трех онтологий. 2.Термины имеют код обоснования аннотации

DAG — ориентированный ациклический граф отношение "is_part_of": "A is part of B" означает, что А — часть В, но В не обязательно содержит А. отношение "_is_a": "A is B" означает, что А — частный случай В;

Evidence Codes IDA Inferred from Direct Assay TAS Traceable Author Statement IMP Inferred from Mutant Phenotype IGI Inferred from Genetic Interaction IPI Inferred from Physical Interaction RCA Inferred from Reviewed Computational Analysis ISS Inferred from Sequence Similarity IEP Inferred from Expression Pattern NAS Non-traceable Author Statement IEA Inferred from Electronic Annotation IC Inferred by Curator ND No biological Data available

Статистика GO Biological process terms 9805 Molecular function terms 7076 Cellular component terms 1574 Genomes with annotation* 30 Annotated gene products  Total  Electronic only  Manually curated ______________________________________ * Excludes annotations from UniProt, which represent 261 annotated proteomes.

Есть и другие онтологии, например, exon, promoter, binding_site, non_canonical_splice_site, stop_codon. pseudogene

Резюме Функциональная аннотация геномов — задача биоинформатики Существуют энциклопедии, где можно узнать о функциях генов и их продуктов, например, BioCyc. Полное описание функции — это ответы на вопросы "где?", "зачем?", "как?“, "с чем?“. GO — перспективный подход к разработке общего языка (решение проблема синонимов), разработке формализованного описания функций, общего для всех организмов.