The gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes.

Slides:



Advertisements
Similar presentations
Neutral Theory of Molecular Evolution most base substitutions are selectively neutral drift dominates evolution at the molecular level Under drift, rate.
Advertisements

IMPRS workshop Comparative Genomics 18 th -21 st of February 2013 Lecture 4 Positive selection.
Evolution of genomes.
Quick Lesson on dN/dS Neutral Selection Codon Degeneracy Synonymous vs. Non-synonymous dN/dS ratios Why Selection? The Problem.
Chapter 19 Evolutionary Genetics 18 and 20 April, 2004
Plant of the day! Pebble plants, Lithops, dwarf xerophytes Aizoaceae
Molecular Evolution GE3M17 Mario A. Fares. Nothing in biology makes sense except in the light of evolution Dobzhansky, 1973.
Molecular Evolution Revised 29/12/06
Molecular evolution:   how do we explain the patterns of variation observed in DNA sequences? how do we detect selection by comparing silent site substitutions.
14 Molecular Evolution and Population Genetics
MCB 5472 The Queue, Phylogenetic Reconstruction and Selection Peter Gogarten Office: BSP 404 phone: ,
The gradualist point of view (review) Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages.
The gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes.
MCB 372 Phylogenetic reconstruction Peter Gogarten Office: BSP 404 phone: ,
From population genetics to variation among species: Computing the rate of fixations.
The gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes.
The origins & evolution of genome complexity Seth Donoughe Lynch & Conery (2003)
Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.
The gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes.
MCB 5472 Types of Selection Peter Gogarten Office: BSP 404 phone: ,
Positive selection A new allele (mutant) confers some increase in the fitness of the organism Selection acts to favour this allele Also called adaptive.
Molecular Clocks, Base Substitutions, & Phylogenetic Distances.
Trees – what might they mean? Calculating a tree is comparatively easy, figuring out what it might mean is much more difficult. If this is the probable.
Molecular Evolution, Part 2 Everything you didn’t want to know… and more! Everything you didn’t want to know… and more!
MCB 371/372 quartets positive selection 4/20/05 Peter Gogarten Office: BSP 404 phone: ,
Adaptive Molecular Evolution Nonsynonymous vs Synonymous.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Chapter 3 Substitution Patterns Presented by: Adrian Padilla.
Natural Selection Developed by Charles Darwin in 1859
- any detectable change in DNA sequence eg. errors in DNA replication/repair - inherited ones of interest in evolutionary studies Deleterious - will be.
In the deterministic model, the time till fixation depends on the selective advantage, but fixation is guaranteed.
Selection versus drift The larger the population the longer it takes for an allele to become fixed. Note: Even though an allele conveys a strong selective.
1. Natural selection can only occur if there is variation among members of the same species. WHY? Variation in a population results from mutation and.
Models of Molecular Evolution I Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.1 – 7.2.
Lecture 25 - Phylogeny Based on Chapter 23 - Molecular Evolution Copyright © 2010 Pearson Education Inc.
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
Neutral theory: The vast majority of observed sequence differences between members of a population are neutral (or close to neutral). These differences.
Calculating branch lengths from distances. ABC A B C----- a b c.
Identifying and Modeling Selection Pressure (a review of three papers) Rose Hoberman BioLM seminar Feb 9, 2004.
Models of Molecular Evolution III Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.5 – 7.8.
EVOLUTION AND NATURAL SELECTION. QUICK REVIEW SUMMARY OF THE HISTORY OF EVOLUTIONARY THOUGHT.
Population and Evolutionary Genetics
Remainder of Chapter 23 Read the remaining materials; they address information specific to understanding evolution (e.g., variation and nature of changes)
Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.
Selectionist view: allele substitution and polymorphism
N=50 s=0.150 replicates s>0 Time till fixation on average: t av = (2/s) ln (2N) generations (also true for mutations with negative “s” ! discuss among.
NEW TOPIC: MOLECULAR EVOLUTION.
Bayes’ Theorem Reverend Thomas Bayes ( ) Posterior Probability represents the degree to which we believe a given model accurately describes the.
Why could a gene tree be different from the species tree? Lack of resolution Lineage sorting Gene duplications/gene loss (paralogs/orthologs) Gene transfer.
Evolution at the Molecular Level. Outline Evolution of genomes Evolution of genomes Review of various types and effects of mutations Review of various.
Testing the Neutral Mutation Hypothesis The neutral theory predicts that polymorphism within species is correlated positively with fixed differences between.
Genetics. Mutations of Genes Mutation – change in the nucleotide base sequence of a genome; rare Not all mutations change the phenotype Two classes of.
In populations of finite size, sampling of gametes from the gene pool can cause evolution. Incorporating Genetic Drift.
Modelling evolution Gil McVean Department of Statistics TC A G.
The gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes.
Phylogenetic reconstruction, probability mapping, types of selection. Peter Gogarten Office: BSP 404 phone: ,
Schematic of Eukaryotic Protein-Coding Locus
LBA ProtPars. LBA Prot Dist no Gamma and no alignment.
Lecture 6 Genetic drift & Mutation Sonja Kujala
Causes of Variation in Substitution Rates
The neutral theory of molecular evolution
Neutrality Test First suggested by Kimura (1968) and King and Jukes (1969) Shift to using neutrality as a null hypothesis in positive selection and selection.
Intro to microbial evolution
Distances.
What are the Patterns Of Nucleotide Substitution Within Coding and
Phylogenetic reconstruction
Pedir alineamiento múltiple
DN/dS.
Section 20.4 Mutations and Genetic Variation
Evolution Where we came from….
Presentation transcript:

the gradualist point of view Evolution occurs within populations where the fittest organisms have a selective advantage. Over time the advantages genes become fixed in a population and the population gradually changes. Note: this is not in contradiction to the the theory of neutral evolution. (which says what ?) Processes that MIGHT go beyond inheritance with variation and selection? Horizontal gene transfer and recombination Polyploidization (botany, vertebrate evolution) see here or herehere Fusion and cooperation of organisms (Kefir, lichen, also the eukaryotic cell) Targeted mutations (?), genetic memory (?) (see Foster's and Hall's reviews on directed/adaptive mutations; see here for a counterpoint)Foster'sHall'shere Random genetic drift Gratuitous complexity Selfish genes (who/what is the subject of evolution??) Parasitism, altruism, MoronsMorons Evolutionary capacitors Hopeless monsters (in analogy to Goldschmidt’s hopeful monsters)Hopeless monstershopeful monsters

selection versus drift see Kent Holsinger’s java simulations at The law of the gutter. compare drift versus select + driftdriftselect + drift The larger the population the longer it takes for an allele to become fixed. Note: Even though an allele conveys a strong selective advantage of 10%, the allele has a rather large chance to go extinct. Note#2: Fixation is faster under selection than under drift. BUT

s=0 Probability of fixation, P, is equal to frequency of allele in population. Mutation rate (per gene/per unit of time) = u ; freq. with which allele is generated in diploid population size N =u*2N Probability of fixation for each allele = 1/(2N) Substitution rate = frequency with which new alleles are generated * Probability of fixation= u*2N *1/(2N) = u Therefore: If f s=0, the substitution rate is independent of population size, and equal to the mutation rate !!!! (NOTE: Mutation unequal Substitution! ) This is the reason that there is hope that the molecular clock might sometimes work. Fixation time due to drift alone: t av =4*N e generations (N e =effective population size; For n discrete generations N e = n/(1/N 1 +1/N 2 +…..1/N n )

s>0 Time till fixation on average: t av = (2/s) ln (2N) generations (also true for mutations with negative “s” ! discuss among yourselves) E.g.: N=10 6, s=0: average time to fixation: 4*10 6 generations s=0.01: average time to fixation: 2900 generations N=10 4, s=0: average time to fixation: generations s=0.01: average time to fixation: generations => substitution rate of mutation under positive selection is larger than the rate wite which neutral mutations are fixed.

Random Genetic Drift Selection Allele frequency advantageous disadvantageous Modified from from

Positive selection A new allele (mutant) confers some increase in the fitness of the organism Selection acts to favour this allele Also called adaptive selection or Darwinian selection. NOTE : Fitness = ability to survive and reproduce Modified from from

Advantageous allele Herbicide resistance gene in nightshade plant Modified from from

Negative selection A new allele (mutant) confers some decrease in the fitness of the organism Selection acts to remove this allele Also called purifying selection Modified from from

Deleterious allele Human breast cancer gene, BRCA2 Normal (wild type) allele Mutant allele (Montreal 440 Family) 4 base pair deletion Causes frameshift Stop codon 5% of breast cancer cases are familial Mutations in BRCA2 account for 20% of familial cases Modified from from

Neutral mutations Neither advantageous nor disadvantageous Invisible to selection (no selection) Frequency subject to ‘drift’ in the population Random drift – random changes in small populations

Types of Mutation-Substitution Replacement of one nucleotide by another Synonymous (Doesn’t change amino acid) –Rate sometimes indicated by Ks –Rate sometimes indicated by d s Non-Synonymous (Changes Amino Acid) –Rate sometimes indicated by Ka –Rate sometimes indicated by d n (this and the following 4 slides are from mentor.lscf.ucsb.edu/course/ spring/eemb102/lecture/Lecture7.ppt)

Genetic Code – Note degeneracy of 1 st vs 2 nd vs 3 rd position sites

Genetic Code Four-fold degenerate site – Any substitution is synonymous From: mentor.lscf.ucsb.edu/course/spring/eemb102/lecture/Lecture7.ppt

Genetic Code Two-fold degenerate site – Some substitutions synonymous, some non-synonymous From: mentor.lscf.ucsb.edu/course/spring/eemb102/lecture/Lecture7.ppt

Measuring Selection on Genes Null hypothesis = neutral evolution Under neutral evolution, synonymous changes should accumulate at a rate equal to mutation rate Under neutral evolution, amino acid substitutions should also accumulate at a rate equal to the mutation rate From: mentor.lscf.ucsb.edu/course/spring/eemb102/lecture/Lecture7.ppt

Counting #s/#a Ser Ser Ser Ser Ser Species1 TGA TGC TGT TGT TGT Ser Ser Ser Ser Ala Species2 TGT TGT TGT TGT GGT #s = 2 sites #a = 1 site #a/#s=0.5 Modified from: mentor.lscf.ucsb.edu/course/spring/eemb102/lecture/Lecture7.ppt To assess selection pressures one needs to calculate the rates (Ka, Ks), i.e. the occurring substitutions as a fraction of the possible syn. and nonsyn. substitutions. Things get more complicated, if one wants to take transition transversion ratios and codon bias into account. See chapter 4 in Nei and Kumar, Molecular Evolution and Phylogenetics.

dambe Two programs worked well for me to align nucleotide sequences based on the amino acid alignment, One is DAMBE (only for windows). This is a handy program for a lot of things, including reading a lot of different formats, calculating phylogenies, it even runs codeml (from PAML) for you.DAMBE The procedure is not straight forward, but is well described on the help pages. After installing DAMBE go to HELP -> general HELP -> sequences -> align nucleotide sequences based on …-> If you follow the instructions to the letter, it works fine. DAMBE also calculates Ka and Ks distances from codon based aligned sequences.

dambe (cont)

aa based nucleotide alignments (cont) An alternative is the tranalign program that is part of the emboss package. On bbcxsrv1 you can invoke the program by typing tranalign. Instructions and program description are here.here If you want to use your own dataset in the lab on Monday, generate a codon based alignment with either dambe or tranalign and save it as a nexus file and as a phylip formated multiple sequence file (using either clustalw, PAUP (export or tonexus), dambe, or readseq on the web)readseq

PAML (codeml) the basic model

Vincent Daubin and Howard Ochman: Bacterial Genomes as New Gene Homes: The Genealogy of ORFans in E. coli. Genome Research 14: , 2004 The ratio of non- synonymous to synonymous substitutions for genes found only in the E.coli - Salmonella clade is lower than 1, but larger than for more widely distributed genes. Fig. 3 from Vincent Daubin and Howard Ochman, Genome Research 14: , 2004

Trunk-of-my-car analogy: Hardly anything in there is the is the result of providing a selective advantage. Some items are removed quickly (purifying selection), some are useful under some conditions, but most things do not alter the fitness. Could some of the inferred purifying selection be due to the acquisition of novel detrimental characteristics (e.g., protein toxicity, HOPELESS MONSTERS)?

Other ways to detect positive selection Selective sweeps -> fewer alleles present in population (see contributions from Archaic Humans for example) Repeated episodes of positive selection -> high dN

Variant arose about 5800 years ago

The age of haplogroup D was found to be ~37,000 years