National Centre for Biotechnology Education The PCR and Plant evolution Copyright © Dean Madden, 2012

Stroma Outer membrane Inner membrane Starch granule Granum Stroma lamellae Lipid globule DNA within the chloroplast

Copyright © Dean Madden, 2012 Passed on in ovules No recombination Highly conserved (only insertions, deletions, and substitutions) 120–150 kb Encodes ~80 proteins Essential for photosynthesis Chloroplast DNA

Copyright © Dean Madden, 2012 RuBisCo

Copyright © Dean Madden, 2012 Angiosperm Phylogeny Group

Copyright © Dean Madden, 2012

RuBisCo — DNA sequence data AGP DNA encoding tRNA — Stable, in all plants Non-coding regions — High mutation rate NCBE/SAPS kit

Copyright © Dean Madden, 2012 tRNAtRNANON-CODING 300–500 bp Variation in the size of this region

Copyright © Dean Madden, 2012 Active site here strips primers from the DNA DNA is made at this active site

Copyright © Dean Madden, 2012 Taq polymerase Non-target DNA Target DNA Primers 50–65 °C Primers anneal to complementary sequences of bases in the single- stranded target DNA 72 °C Taq DNA polymerase Makes double-stranded DNA, using the single strands as templates 94–98 °C The double-stranded DNA is split into two strands

Copyright © Dean Madden, 2012 Taq polymerase Non-target DNA Target DNA Primers Start First cycle Second cycleThird cycleFourth cycle

Copyright © Dean Madden, 2012 Mass A microgram is one millionth of a gram micrograms (µg) = 1 milligram (mg) milligrams = 1 gram (g) Volume A microlitre is one millionth of a litre microlitres (µL) = 1 millilitre (mL) millilitres = 1 litre (L)

Copyright © Dean Madden, 2012 Soft rubber tubing Yellow graduated tip HOLD HERE Do not touch the point! 10 µL 20 µL 50 µL 100 µL Measure to the top of each band

Copyright © Dean Madden, 2012 Microsyringe Graduated tip HOLD HERE Do not touch the point! 10 µL 2 µL

Copyright © Dean Madden, 2012 Fixed volume micropipette Use yellow tips to dispense 20 µL volumes

Copyright © Dean Madden, 2012 Summary of the procedure

Copyright © Dean Madden, 2012 Place the leaf tissue on the card Ensure that it fits within the box

Copyright © Dean Madden, 2012 Close the cover and squash the leaf

Copyright © Dean Madden, 2012 Write the plant’s name in pencil on the cover Allow the card to dry for one hour

Copyright © Dean Madden, 2012 Cut discs using a punch

Copyright © Dean Madden, 2012 Push the disc from the punch using some plastic ‘wire’

Copyright © Dean Madden, µL Wash the disc twice in purification reagent Add 100 µL of purification reagent Flick to mix Remove the liquid REPEAT

Copyright © Dean Madden, µL Wash the disc twice in TE-1 buffer Add 100 µL of TE- 1 buffer Flick to mix Remove the liquid REPEAT

Copyright © Dean Madden, 2012 Primer 1 10 µL Primer 2 10 µL Water 4 or 6 µL PCR ‘bead’, containing: – Taq polymerase – buffer – dNTPs – magnesium chloride Primer 1: 5’–CGAAATCGGTAGACGCTACG–3’ Primer 2: 5’–GGGGATAGAGGGACTTGAAC–3’

Copyright © Dean Madden, 2012 Use forceps to add a disc to the plant DNA Label the tube

Copyright © Dean Madden, seconds Repeat this three-step cycle 30 times

Copyright © Dean Madden, 2012

Frosted panel on this side Molten agarose 55–60 °C

Copyright © Dean Madden, 2012 Cut two electrodes Carbon fibre tissue 42 mm 22 mm

Copyright © Dean Madden, 2012 Pour 2–3 mm depth of buffer over the gel before you ease the comb out

Copyright © Dean Madden, 2012 Mix loading dye into each DNA sample 2 µL Bromophenol blue loading dye Amplified DNA sample

Copyright © Dean Madden, 2012 Label the end of the tank to show the contents of each well Black card under the tank reveals the wells for loading Load the DNA through the buffer, taking care not to puncture the wells as you do so

Copyright © Dean Madden, 2012 Electrodes

Copyright © Dean Madden, 2012 Direction of DNA movement Place a comb over the tank to reduce evaporation

Copyright © Dean Madden, 2012 Leave the stain on for 4 minutes only Azure A stain

Copyright © Dean Madden, 2012 DNA Positively-charged Azure A binds to the negatively-charged phosphate groups of the DNA

Copyright © Dean Madden, 2012 Area with DNA bands WellsLoading dye

Copyright © Dean Madden, 2012 DNA ‘ruler’ or ‘ladder’ Sizes are in kb