1T49 Allosteric Inhibition of Protein Tyrosine Phosphatase 1B

Slides:

Advertisements

Similar presentations

AutoDock 4 and AutoDock Vina -Brief Intruction

Advertisements

Overview of Key ICM Features NIBR - Emeryville July

Jürgen Sühnel Institute of Molecular Biotechnology, Jena Centre for Bioinformatics Jena / Germany Supplementary Material:

Molecular dynamics refinement and rescoring in WISDOM virtual screenings Gianluca Degliesposti University of Modena and Reggio Emilia Molecular Modelling.

Establishing a Successful Virtual Screening Process Stephen Pickett Roche Discovery Welwyn.

Molecular Docking G. Schaftenaar Docking Challenge Identification of the ligand’s correct binding geometry in the binding site ( Binding Mode ) Observation:

QM/MM Study of Cytochrome P450 BM3 Catalysis Mechanism and Application in Drug Design.

Quantative Structure- Activity Relationships. Why QSAR? The number of compounds required for synthesis in order to place 10 different groups in 4 positions.

Pharmacophore-based Molecular Docking Bert E. Thomas, Diane Joseph- McCarthy, Juan C.Avarez.

Design of Small Molecule Drugs Targeted to RNA RNA Ontology Group May

Chemoinformatics in Molecular Docking and Drug Discovery.

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG

Tutorials for protein data bank and swiss PDB viewer 2010/04/19 Prof. Jinn-Moon Yang Yen-Fu Chen and Kai-Cheng Hsu

Drug Design Process Discovery Phase. Tripos Software n SYBYL & its modules SYBYL, Concord, MOLCAD, SiteId, Advanced Computation, GASP, DISCOtech, HQSAR,

Computational Techniques in Support of Drug Discovery October 2, 2002 Jeffrey Wolbach, Ph. D.

Module 2: Structure Based Ph4 Design

Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.

Chapter 3 Nucleic Acids, Proteins and Enzymes. Nucleic Acids Informational polymers Made of C,H,O,N and P No general formula Examples: DNA and RNA.

1 Total size of the pipeline Citeline annual review 2012 ?? Adverse drug reactions (ADMET) Can Ayurvedic Treatment Help in Integrating with Modern.

Enzymes Functions and Control. Enzyme Terms  Substrate - the material and enzyme works on.  Enzyme names: Ex. Sucrase - ase name of an enzyme - ase.

DE NOVO DESIGN OF A THYMIDYLATE KINASE INHIBITOR.

Enzymes (If you don’t have the energy, we can help!)

In silico discovery of inhibitors using structure-based approaches Jasmita Gill Structural and Computational Biology Group, ICGEB, New Delhi Nov 2005.

 Receptors are mostly membrane-bound proteins that selectively bind small molecules called ligands which results in physiological response.  They are.

Tutorials for protein data bank and swiss PDB viewer 2010/04/12 Prof. Jinn-Moon Yang Yen-Fu Chen and Kai-Cheng Hsu

Overview of Targeted Therapy Mechanisms November 11, 2011 Targeted Therapies and Biological Therapies SIG.

Virtual Screening C371 Fall INTRODUCTION Virtual screening – Computational or in silico analog of biological screening –Score, rank, and/or filter.

The Importance of Understanding DUSP5 for Angiogenesis Prevention Brandon S Uhler, Daniel Jashinsky, Scott Beard Marquette University, Milwaukee WI Mentor:

Hierarchical Database Screenings for HIV-1 Reverse Transcriptase Using a Pharmacophore Model, Rigid Docking, Solvation Docking, and MM-PB/SA Junmei Wang,

Structure-guided design of a selective BCL-X L inhibitor Structure-guided design of a selective BCL-X L inhibitor Tianlei Sun 2013/11/26.

INFSO-RI Enabling Grids for E-sciencE EGEE Review WISDOM demonstration Vincent Bloch, Vincent Breton, Matteo Diarena, Jean Salzemann.

Group Red – Demacia Gabe, Chris, Tom. - Enzymes with more than one polypeptide chain can change between an active shape and an inactive shape - When the.

Themes: Structure meets Function

VISUALIZATION IN BIOLOGY Rama Viswanathan Professor of Chemistry and Computer Science (At Beloit College since 1983)

CoMFA Study of Piperidine Analogues of Cocaine at the Dopamine Transporter: Exploring the Binding Mode of the 3  -Substituent of the Piperidine Ring Using.

Molecular mechanics Classical physics, treats atoms as spheres Calculations are rapid, even for large molecules Useful for studying conformations Cannot.

EBI is an Outstation of the European Molecular Biology Laboratory. A web based integrated search service to understand ligand binding and secondary structure.

Docking and Virtual Screening Using the BMI cluster

Molecular Modeling in Drug Discovery: an Overview

HP-SEE In the search of the HDAC-1 inhibitors. The preliminary results of ligand based virtual screening Ilija N. Cvijetić, Ivan O. Juranić,

Nehad A. El Sayed, Amal A. H. Eissa, Reem K. Arafa and Ghada F. El Masry* Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University.

Structure-based inhibitor design and validation: Application to Plasmodium falciparum glutathione S-transferase Marli Botha MSc. Bioinformatics.

Structural Bioinformatics Elodie Laine Master BIM-BMC Semester 3, Genomics of Microorganisms, UMR 7238, CNRS-UPMC e-documents:

Sequence: PFAM Used example: Database of protein domain families. It is based on manually curated alignments.

Annual Health Insurance Premiums And Household Income,

Computational Docking Experiments to Find a Ligand that Will Bind to Xanthine Oxidase Lysengkeng Her and Thao Yang Department of Chemistry, University.

DATA MINING FOR SMALL MOLECULE ALLOSTERIC INHIBITORS

Ligand-Based Structural Hypotheses for Virtual Screening

Molecular Docking Profacgen. The interactions between proteins and other molecules play important roles in various biological processes, including gene.

Richard S. L. Stein CS 379a March 14, 2006

Study of structural-chemistry of sodium 4-phenylbutyrate

Virtual Screening.

Bindings of oliver leaf extract (OLE) to HIV-1 fusion protein gp41 John Z.H. Zhang, Department of Chemistry, New York University Recent experimental study.

Volume 7, Issue 12, Pages (December 2000)

Dynamic Hinge Regions co-localize with Biological Important Residues

Crystal Structures of Sirt3 Complexes with 4′-Bromo-Resveratrol Reveal Binding Sites and Inhibition Mechanism Giang Thi Tuyet Nguyen, Melanie Gertz,

Structure of an LDLR-RAP Complex Reveals a General Mode for Ligand Recognition by Lipoprotein Receptors Carl Fisher, Natalia Beglova, Stephen C. Blacklow

Alexey Sulimov, Ekaterina Katkova, Vladimir Sulimov,

Volume 11, Issue 6, Pages (June 2004)

The Case of the Disappearing Drug Target

Crystal Structures of a Ligand-free and Malonate-Bound Human Caspase-1

Accounting for side-chain flexibility in protein-ligand docking: 3D Interaction Homology as an approach of quantifying side-chain flexibility of Tyrosine.

Conformation-Selective ATP-Competitive Inhibitors Control Regulatory Interactions and Noncatalytic Functions of Mitogen-Activated Protein Kinases Sanjay B.

Novel FKBP inhibitors identified by synthetic approaches (A to D) and by screening of databases and compound libraries (E to H), as well as pipecolinic.

Allen R. Buskirk, David R. Liu Chemistry & Biology

Fig. 6 Covalent inhibition of tuberculosis target MptpB.

Summary of the new mechanistic findings of the present study.

Volume 84, Issue 4, Pages (April 2003)

Docking validation of Dud778-dUTPase cocrystal structure.

Presentation transcript:

1T49 Allosteric Inhibition of Protein Tyrosine Phosphatase 1B Reference:

Methods Structure-based Virtual Screening - UNITY for 1st screening of database from ‘Zinc’, Lead-Quest (4,850). - FlexS for flexible superposition of ligands. - FlexX for flexible docking.(139) - These modules are included in the SYBYL version 8.1 software (Tripos Inc.)

Structure-Based Virtual Screening 1st filtering by Unity 3D Search :queries based on the PTP1B structure (PDB id= 1T49) 2nd filtering: Flexible superposition by FlexS Template ; Lobaric acid 3rd filtering: Flexible docking and scoring by FlexX / CScore Query used to Unity 3D search for PTP1B-selective inhibitor. Magenta ligand is the reported PTP1B inhibitor

A Drug-enzyme Binding Model Changon Seo et al., 2009

Noncompetitive Inhibitors of PTP1B Christian Wiesmann et al., 2004

Docking Modes of Active Compounds into Allosteric Site Compound 1 (Lobaric acid) Compound 1 (Carboxylate form) Compound 2 Compound 3 Compound 8 Compound 9

Active Ligands by Flexible Superposition Benzene ring interacting with Phe280 H-bonding with Asn193 Two hydrophobic alkyl chains

An Active Ligand inhibiting PTP1B activity Zinc 7589409 (Score: -21.633) Lobaric acid (Score: -19.908) Hydrophobicity Potential (PDB id: 1T49)

References Changon Seo, Jae Hak Sohn, Jong Seog Ahn, Joung Han Yim, Hong Kum Lee, Hyuncheol Oh (2009) Protein tyrosine phosphatase 1B inhibitory effects of depsidone and pseudodepsidone metabolites from the Antarctic lichen Stereocaulon alpinum, Bioorganic & Medicinal Chemistry Letters 19 2801–2803 Christian Wiesmann, Kenneth J Barr, Jenny Kung, Jiang Zhu, Daniel A Erlanson, Wang Shen, Bruce J Fahr, Min Zhong, Lisa Taylor, Mike Randal, Robert S McDowell & Stig K Hansen (2004) Allosteric inhibition of protein tyrosine phosphatase 1B, Nature Structural & Molecular Biology 11, 730 - 737