Specificity of argonaute protein association with miRNA Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert.

Slides:

Advertisements

Similar presentations

Rhiana Lau MMG C174 Professor Simpson

Advertisements

Identification of the Plant Systemic RNA Silencing Signal 2008 Summer HHMI Program Simon Johnson Mentors: Dr. James C. Carrington – Professor and Director.

Gene Regulation in Eukaryotic Cells. Gene regulation is complex Regulation, and therefore, expression of a gene is complex. Regulation of these genes.

TuMV, miRNAs and Arabidopsis thaliana Amy Shatswell HHMI Summer Research 2006 Carrington Lab.

Pancreatic Islets within Pancreas. Modulators of Insulin Secretion.

Distinct Roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA Silencing Pathways Lee, S.Y., Nakahara, K., Phan, J.W., Kim, K., He, Z., Sontheimer,

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite

Role of Arabidopsis RNA- Dependent RNA Polymerase Genes 3, 4 and 5 in Antiviral Defense Nick Lowery Dr. James C. Carrington Dr. Hernan Garcia-Ruiz Oregon.

Translational Inhibition in Arabidopsis thaliana Russell Burke Dr. James Carrington Botany and Plant Pathology.

Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.

Chapter 15 Noncoding RNAs. You Must Know The role of noncoding RNAs in control of cellular functions.

Establishment of a System to Replicate, Purify, and Use a Mutant RNA Virus to Study the Antiviral Defense Response in Plants Katie Brempelis Mentors: Dr.

More regulating gene expression. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing and transport.

Control of Gene Expression Eukaryotes. Eukaryotic Gene Expression Some genes are expressed in all cells all the time. These so-called housekeeping genes.

Transfection. What is transfection? Broadly defined, transfection is the process of artificially introducing nucleic acids (DNA or RNA) into cells, utilizing.

Identifying and classifying functional small RNAs from pine Ryan Morin BC Genome Sciences Centre (presenting research conducted in the lab of Dr. Peter.

Where Will They Strike Next? microRNA targeting tactics in the war on gene expression Jeff Reid Miller “Lab” Baylor College of Medicine.

Regulating Gene Expression from RNA to Protein. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing.

RNA Folding. RNA Folding Algorithms Intuitively: given a sequence, find the structure with the maximal number of base pairs For nested structures, four.

More regulating gene expression. Combinations of 3 nucleotides code for each 1 amino acid in a protein. We looked at the mechanisms of gene expression,

MBP1007/ Nucleic Acids A functional mRNA: The cytoplasmic story Objectives (1) To discuss the iNUTS and iBOLTS of how mRNAs function in the cytoplasm.

Changes to Syllabus: Quizzes put back: Change Oct. 3 to Oct. 17

Welcome Everyone. Self introduction Sun, Luguo ( 孙陆果） Contact me by Professor in School of Life Sciences & National Engineering.

Drosha. 121th Lab meeting 석사 2 년 박 은 실.

MicroRNA regulation in Arabidopsis thaliana

Characterization of RDR Gene Expression Johnny R. Nunez and Lisa K. Johansen Community College of Denver and University of Colorado at Denver and Health.

MicroRNAs and Other Tiny Endogenous RNAs in C. elegans Annie Chiang JClub Ambros et al. Curr Biol 13:

MiRNA Reading: Lecture notes.

Advantages of C. elegans: 1. rapid life cycle 2. hermaphrodite 3. prolific reproduction 4. transparent 5. only ~1000 cells 6. laser ablation 7. complete.

Control of Gene Expression. Ways to study protein function by manipulating gene expression Mutations –Naturally occurring, including human and animal.

Trumpet leaves and microRNA Catherine Kidner CSHL.

The Antiviral Response in Plants: RNA Silencing Melissa Andreas Carrington Lab HHMI - Oregon State University Summer 2007.

Atta ur Rahman school of biological Science National University of Sciences & Technology CMB-234:Molecular Biology.

MiRNAs and siRNAs 5 th March 2013 Saeideh Jafarinejad 4/22/2013 Rhumatology Research Center Lab(RRC lab)

A validation of a two-step control model

From: Emerging Roles for MicroRNAs in Perioperative Medicine

Schematic representation of the microRNA biogenesis machinery.

Figure 2 Dicer and RISC (RNA-induced silencing complex).

The complex world of kidney microRNAs

Biochemical Specialization within Arabidopsis RNA Silencing Pathways

Volume 107, Issue 7, Pages (December 2001)

Volume 21, Issue 22, Pages (November 2011)

MicroRNAs: regulators of gene expression and cell differentiation

C. Belair, F. Darfeuille, C. Staedel

Volume 42, Issue 3, Pages (May 2011)

SP1 was a downstream target of miR-150-3p

Volume 13, Issue 1, Pages (July 2007)

Volume 21, Issue 22, Pages (November 2011)

Edwards Allen, Zhixin Xie, Adam M. Gustafson, James C. Carrington Cell

A Seed Mismatch Enhances Argonaute2-Catalyzed Cleavage and Partially Rescues Severely Impaired Cleavage Found in Fish Grace R. Chen, Hazel Sive, David.

Slicing-Independent RISC Activation Requires the Argonaute PAZ Domain

Volume 116, Issue 2, Pages (January 2004)

Marc Spingola, Manuel Ares Molecular Cell

Young-Hee Cho, Sang-Dong Yoo, Jen Sheen Cell

Asymmetry in the Assembly of the RNAi Enzyme Complex

Sorting of Drosophila Small Silencing RNAs

Prediction of Plant MicroRNA Targets

Volume 42, Issue 3, Pages (May 2011)

MicroRNAs in cancer: biomarkers, functions and therapy

Volume 5, Issue 3, Pages (November 2013)

Volume 133, Issue 1, Pages (April 2008)

HOS1 Facilitates the Phytochrome B-Mediated Inhibition of PIF4 Function during Hypocotyl Growth in Arabidopsis Ju-Heon Kim, Hyo-Jun Lee, Jae-Hoon Jung,

Volume 133, Issue 1, Pages (April 2008)

Lin28 Mediates the Terminal Uridylation of let-7 Precursor MicroRNA

Volume 11, Issue 8, Pages (August 2018)

Loss of miRNA from Ago2 deactivates miRNPs in LPS‐treated mammalian macrophages. Loss of miRNA from Ago2 deactivates miRNPs in LPS‐treated mammalian macrophages.

Eva Gottwein, Bryan R. Cullen Cell Host & Microbe

E4-ORF1 binds endogenous PATJ and redistributes it into detergent-insoluble complexes in MDCK cells. E4-ORF1 binds endogenous PATJ and redistributes it.

MicroRNAs in cancer: biomarkers, functions and therapy

Targeting DCLK1 by miRNA-137.

Presentation transcript:

Specificity of argonaute protein association with miRNA Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert

Importance of small RNA Gene regulation Growth and development Therapeutics Agriculture

miRNA Functions Dicer RISC proteins Target RNA degradation Translation arrest miRNA miRNA precursor (Zamore, Bartel, Sharp, Carrington labs)

Background Small RNA silencing is a mode of gene regulation. Argonaute proteins are the catalytic components of RISC. miRNAs guide AGOs to their targets. The nucleotide at the 5’ end is one source of miRNA specificity.

5’ nucleotide specificity of AGO’s Kim, N. (2008) Cell Montgomery, et. al. (2008) Cell; Mi et. Al. (2008) Cell; Takeda, et. Al. (2008) Plant Cell Physiology

What We Know 5’ nucleotide specificity rule has exceptions. There are miRNA’s that associate with AGO1 and lack 5’U. AGO7 has no known 5’end nucleotide specificity. – Instead it only binds miR390. GOAL: Understand the rules of miRNA association with AGO’s.

miRNA Sequence miRNA’s that deviate from AGO1, 5’U rule contain U at eleventh position. Hypothesis: A uracil at position 11 is important for association with AGO1. miR390: AAGCUCAGGAGGGAUAGCGCC Binds AGO7 miR390-11U: AAGCUCAGGA U GGAUAGCGCC Binds AGO1 ??? miR172: AGAAUCUUGAUGAUGCUGCAU Binds AGO1 miR172-11G: AGAAUCUUGA G GAUGCUGCAU Binds AGO1 ???

How Construct mutant miRNAs. Infiltrate Nicotania benthamiana with constructs containing miRNAs, tagged proteins, and appropriate controls. Co-immunoprecipitation Small RNA gels HA-AGO Tissue Immunoprecipitate using HA antibody IP Fraction Small RNA gels Lyse Cells Input Fraction Small RNA gels

Position 11U Results miR172-11G associates with AGO1 11U is not a specificity determinant. Vector in HA HA-AGO1 in HA HA-AGO7 in HA Vector miR172 miR172-11G Vector miR390 miR390-11U Vector in HA HA-AGO1 in HA HA-AGO7 in HA miR390-11U associates with AGO7 and not AGO1 HA-AGO Tissue Immunoprecipitate using HA antibody IP Fraction Small RNA gels Lyse Cells Input Fraction Small RNA gels

Determine how non-5’U miRNAs are specified Too much background miR390 and miR172 Make new system using a miRNA that is distinguishable from endogenous miRNA but is still processed efficiently.

Alteration of miR390 Eliminate competition with other AGOs. Purine and pyrimidine conservation. Changed position 19 from a G to C – Choose miRNA over miRNA* Changed position 1 from an A to a G – 5’ end of miR390 doesn’t play a role in association. miR390: AAGCUCAGGAGGGAUAGCGCC miR390-5’G: G AGCUCAGGAGGGAUAGCGCC miR390: AAGCUCAGGAGGGAUAGCGCC miR390-19C: AAGCUCAGGAGGGAUAGC C CC

Alteration of miR390 Prediction: Both miR390-5’G and miR390-19C should bind AGO7 and accumulate as well as endogenous miR390.

miR390 Alteration Results miR390-5’G creates a 19 nucleotide small RNA miR390-19C accumulates more

miR390-5’G associates with AGO7 even though it is a 19 nucleotide small RNA. miR390 Alteration Results

Future Plans Create miR390 with single point mutations at every position. Test nonconserved miRNAs.

Acknowledgement Howard Hughes Medical Institute Dr. Jim Carrington Dr. Sunny Gilbert The Carrington Lab