Reliability of ITS in Species Identification by Surachit Waengsothorn.

Slides:

Advertisements

Similar presentations

Introduction to Evolution

Advertisements

Species concept. Mass Length Different species usually form clusters of phenotypes.

The History of Classification Out of this concept was developed the "scale of nature" idea that suggested living things were arranged on a scale of perfection,

Classification and Taxonomy Heather M Hawkins Office Hours: 11-2 LS 464.

Until more recent times, scientists named Things with crazy long names that Just described the organism. Apis pubescens, thorace subgriseo, abdomine.

Classification of Organisms. Categories of Biological Classification Scientists Assign Organisms Two-Word Names 2,000 yrs ago, Aristotle grouped plants.

THE EVOLUTIONARY HISTORY OF BIODIVERSITY

MICROBIAL TAXONOMY Phenotypic Analysis Genotypic Analysis.

Classification of Living Things. 2 Taxonomy: Distinguishing Species Distinguishing species on the basis of structure can be difficult  Members of the.

Lesson 3: Phylogeny & Modern Taxonomy

PHYLOGENY AND SYSTEMATICS

BIOE 109 Summer 2009 Lecture 11-Part I Species concepts.

Microbial Diversity.

Evolution: Animal Diversity - Part 1 Biology 155 Krilowicz Spring 2010.

Classification and Beyond Chapters 19. Why do we name things? To distinguish one thing from another To communicate with others more effectively It forces.

Biology and the Tree of Life Chapter One. Key Concepts Organisms obtain and use energy are made up of cells, process information, replicate, and as populations.

Systematics The study of biological diversity in an evolutionary context.

DNA in classifying species. Traditional classification Classification of organisms into closely related species, then more distant genuses, phyla and.

Chapter 18 Speciation. What is a Species? The morphological species concept expresses the following: – Species, in its simplest interpretation means “kind”

PCR and Diagnostics Unique sequences of nucleotides if detectable can be used as definitive diagnostic determinants NA hybridisation is the basis for rapid.

Taxonomic Units What is it that we are trying to do? Determine relationships among…? What do the terminal nodes represent? Often, they are supposed to.

How classification works

Species Concepts. What makes each an individual species? Consider the following… Painted Bunting Roseate Spoonbill Barn Owl Northern Mockingbird Bald.

Outstanding Origin of Species Ch 24. Vocabulary  1. Macroevolution – origin of new taxonomic groups (new species, genera, families etc)  2. Speciation.

Part 2 Evolution Notes. Natural Selection and Macroevolution Natural Selection shapes a population, making it adapted to its current environment. This.

Speciation SJCHS. Evolution Microevolution: Change in a population ’ s gene pool from generation to generation Speciation: When one or more new species.

Formation of species. The process of species formation is called? Speciation Scientists use internal and external structures and appearances ( morphology.

Speciation Notes. Biological Species Concept Two organisms belong to the same species IF: 1)They can mate 2)And produce living and fertile offspring.

The Species in Conservation. Taxonomy- the science of classification.

CHAPTER 24 THE ORIGIN OF SPECIES 1.

Updated: January 2015 By Jerald D. Hendrix. A. Classification Systems B. Levels of Classification C. Definition of “Species” D. Nomenclature E. Useful.

Taxonomy Science of describing, naming, and classifying organisms. Designed by Linnaeus Based on morphology (form and structure) –Common name not useful.

Fluidity of the 16S rRNA Gene Sequence within Aeromonas Strains Alessia Morandi Institute for Infectious Diseases University of Berne.

Chapter 24. Microevolution: change in allele frequencies in a population over time Macroevolution: broad pattern of evolution above the species level.

Introduction to Biology. Section 1  Biology and Society Biology  The study of life.

Systematics and the Phylogenetic Revolution Chapter 23.

Chapter 11 (Plant Taxonomy, pp ) Species Concepts.

ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?

Species concepts in biology

26.1 Organisms Evolve Through Genetic Change Occurring Within Populations. “Nothing in Biology makes sense except in the light of Evolution” –Theodosius.

KEY CONCEPT Molecular clocks provide clues to evolutionary history.

PCR has numerous applications :

Location of Hominid fossils worldwide. THE AREAS OF THE WORLD HOMINIDS AND OTHER ANIMALS ARE FOUND IN TODAY MAY SOMETIMES BE VASTLY DIFFERENT THAN IN.

Announcements Urban Forestry data and photos due next week after the break. Reading. Writing assignment due Oct 18. Choose one of the characteristics out.

CHARACTERS USED IN RECONSTRUCTING PHYLOGENETIC TREES 1. Morphological “ Tiktaalik is the sister group of Acanthostega + Ichthyostega in one of the two.

The Tree of Life How do we select a gene sequence for comparison?

Northern Star Coral (Astrangia poculata) Populations from the New Jersey Coast. Abstract- This project investigated the distribution and molecular evolution.

Classification and Phylogenetic Relationships

When does a species evolve from another species, what is/are the signal (s), which determines that the genome differences can be packed into the same number.

Integrative taxonomy Gustav Paulay Florida Museum of Natural History University of Florida.

EVOLUTION & NATURAL SELECTION. Starter Natural selection recap Can you remember natural selection from AS? Outline the process of natural selection.

24.1 The Biological Species Concept emphasizes Reproductive Isolation.

How Biologists Classify Organisms Section What Is a Species? In 1942, the biologist Ernst Mayr of Harvard University proposed the biological species.

1 Classification & Phylogeny of Animals Zoology Chapter 4 Homework: Read pages (up to Taxonomic char…) Do Questions 1, 2, 3, 4 page 86 Due: Tuesday.

Macroevolution and the Definition of Species. Overview: That “Mystery of Mysteries” In the Galápagos Islands Darwin discovered plants and animals found.

Chapter 24.  Evolution leads to potential speciation  One species becoming two or more species  Speciation leads to macroevolution  Broad changes.

Identification of Drosophila species based on 16S rRNA and CO1 gene sequences Mohammad Shamimul Alam, Khandaker Asif Ahmed, Rowshan Ara Begum, and Reza.

Lecture 81 – Lecture 82 – Lecture 83 Modern Classification Ozgur Unal

Biogeography--study of the distributions of organisms on the earth

NAME: DATE: PERIOD: Speciation Plant Sciences, 2001Updated: June 1, 2012 Gale Document Number: GALE|CV Outline key terms Speciation is the process.

Biological Classification: The science of taxonomy

Biological Classification: The science of taxonomy

Chapter 24 The Origin of Species.

24.1 The Biological Species Concept emphasizes Reproductive Isolation

KEY CONCEPT Molecular clocks provide clues to evolutionary history.

Unit 2 revision.

DO NOW In box on note sheet Why is variation important?

Species Concept and Speciation Process

24.1 The Biological Species Concept emphasizes Reproductive Isolation

Variation of the Species

Presentation transcript:

Reliability of ITS in Species Identification by Surachit Waengsothorn

What’s ITS ITS stands for Internal Transcribed Spacer regions Where are they? These regions are located in ribosome.

Ribosomal RNA 5S rRNS5.8s rRNA18s rRNS 120bp 160bp ~1900bp ITS1 ITS2

What’s ITS ITS stands for Internal Transcribed Spacer regions Where are they? These regions are located in ribosome. Why do I pick ITS? rRNA is highly conserved across texa while the ITS may be species-specific.

rRNA evolution rate use Small-subunit very slow distantly related organisms Mitocondrial more rapidly family level ITS fastest variation among species

Species In the past 30 years, over six concepts have been proposed. Species is a very simple word BUT its definition is not that easy. Three majors concepts: -The biological species concept - The phylogenetic species concept - The morphospeceis concept

The biological species concept proposed in 1942 by Ernst Mayr used by many zoologists defined “species” in Endangered Species Act Criterion: reproductive isolation (lack of gene flow) populations do not hybridize populations fail to produce fertile offspring Cons: can be applied to only living organisms difficult to keep tract on all populations

The phylogenetic species concept Criterion: monophyly Populations contain all the know descendants of a single common ancestor. Species are the smallest diagnosable monophyletic groups. The morphospeceis concept: used by paleontologists They define species on the basis of morphological differences among fossils.

All concepts share three things in common: 1) Species consist of interbreeding populations. 2) Species are a fundamental unit of evolution. 3) Species share a distinguishing characteristic.

Why is species identification so important? Species plays a major role in all conservation aspects. Species identification is a starting point of life science disciplines i.e. biology, ecology, forestry, biotechnology, etc. Species identification is daily used in many careers such as farmers, foresters, lawyers, gardeners, researchers, scientists, curators, ete.

Method Data collections: Lab work: - extract DNA from a sugar maple sample. - amplify ITS region using PCR technique. - perform fragment sequencing. 5s RNA 5.8s RNA18s RNA ITS1 primer:TCCGTAGGTGAACCTGCGG ITS4 primer: TCCTCCGCTTATTGATATGC

Method (cont.) Office work: - search around the cool web (NCBI home page) and collect ITS data of maples. - use GCG to perform pileup, pretty - consensus, tofasta. - put fasta file in clastalW, and get the tree from Treeview Data collections:

Results 15 species of maples (genus Acer) 3 sample per species except sugar maple has only 2 samples + 1 sample of mine. Pretty -consensus

Results 15 species of maples (genus Acer) 3 sample per species except sugar maple has only 2 samples + 1 sample of mine. Pretty -consensus Clustal W

Treeview

Data Interpretation Recommendations Unknown sample(s) is(are) recommended to compare with at least three sequences of a known species, and several species in the same genus or different genus in the same family. ITS is a powerful tool to discriminate species. 42 of 45 sequences (>93%) support the hypothesis.