Credits to Vanessa Patel for some of the slides.

Slides:

Advertisements

Similar presentations

IMPRS workshop Comparative Genomics 18 th -21 st of February 2013 Lecture 4 Positive selection.

Advertisements

Quick Lesson on dN/dS Neutral Selection Codon Degeneracy Synonymous vs. Non-synonymous dN/dS ratios Why Selection? The Problem.

Figure 7.1 Genomes 3 (© Garland Science 2007) Figure 7.2 Genomes 3 (© Garland Science 2007)

Atelier INSERM – La Londe Les Maures – Mai 2004

Pattern of similarity between Europeans and Neanderthals Green et al. Science 328, 710 (2010)

The World’s Early People

BME 130 – Genomes Lecture 3 Sequencing technology I The bad old days.

Molecular Evolution with an emphasis on substitution rates Gavin JD Smith State Key Laboratory of Emerging Infectious Diseases & Department of Microbiology.

Positive selection A new allele (mutant) confers some increase in the fitness of the organism Selection acts to favour this allele Also called adaptive.

Reseach Training Presentation By Yanhong Zhao Department of Evolutionary Functional Genomics, Uppsala University, Sweden Supervisor: Prof. Ulf Lagercrantz.

Human population migrations Out of Africa, Replacement –Single mother of all humans (Eve) ~150,000yr –Single father of all humans (Adam) ~70,000yr –Humans.

Welcome to CS374! A survey of computer science in genomics today ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Human Origins in Africa The Beginning. Scientists Search for Human Origins Archaeologists – specially trained scientists that try and discover the past.

- any detectable change in DNA sequence eg. errors in DNA replication/repair - inherited ones of interest in evolutionary studies Deleterious - will be.

The Dawn of Man. Pre-history  In order to understand the development of human civilizations we need to use several different scientific disciplines.

 Archaeology – “the scientific study of material remains (as fossil relics, artifacts, and monuments) of past human life and activities”  Studies.

Molecular Clock. Rate of evolution of DNA is constant over time and across lineages Resolve history of species –Timing of events –Relationship of species.

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012.

APPLICATIONS OF MOLECULAR PHYLOGENETICS

APPLICATIONS OF MOLECULAR PHYLOGENETICS

Introduction to Bioinformatics.

Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.

Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Models of Molecular Evolution III Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections 7.5 – 7.8.

Look at this artifact What is it? How was it made? What does it say about the civilization that created it? Who made it? What was its purpose? What was.

Chapter 3 vocabulary ARCHAEOLOGY archaeology The recovery and study of the remains of the past.

WHAT IS ANTHROPOLOGY? The term originates from two words in Greek: (1) anthropos meaning “man” as in “human being” (1) anthropos meaning “man” as in “human.

Finding Clues To The Past

Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Selectionist view: allele substitution and polymorphism

N=50 s=0.150 replicates s>0 Time till fixation on average: t av = (2/s) ln (2N) generations (also true for mutations with negative “s” ! discuss among.

Human Origins in Africa

Copyright © 2010 Pearson Education, Inc. publishing as Benjamin Cummings Lectures by Greg Podgorski, Utah State University Current Issues in Biology, Volume.

Molecular evolution Part I: The evolution of macromolecules.

Evolution of individual genes in humans

Vocab.  Archeology: the scientific study of material remains (as fossil relics, artifacts, and monuments) of past human life and activities  Culture:

LESSON 8: PowerPoint slides to accompany Using Bioinformatics: Genetic Testing.

In populations of finite size, sampling of gametes from the gene pool can cause evolution. Incorporating Genetic Drift.

Archaeology/paleontology (“ancient DNA” analysis) Conservation biology Forensic science Taxonomy Power & pitfalls of PCR (polymerase chain reaction) Rapid.

BME 130 – Genomes Lecture 20 Population Genomics I.

Lecture 21: Introduction to Phylogenetics November 9, 2015.

The Haplotype Blocks Problems Wu Ling-Yun

Genetic Linkage.

Archaeology Examples.

The Earliest Humans Vocab.

Detection of the footprint of natural selection in the genome

Evolution of gene function

Pipelines for Computational Analysis (Bioinformatics)

Origins of Agriculture, Culture, & Civilization

Genetic Linkage.

Detection of the footprint of natural selection in the genome

The Earliest Humans Vocab.

Fig. 1 Number of somatic mutations in representative human cancers, detected by genome-wide sequencing studies. Number of somatic mutations in representative.

DO NOW In box on note sheet Why is variation important?

Archaeology in History

Genetic Drift, followed by selection can cause linkage disequilibrium

Summary of the population genetics measures used in this study.

Figure 2 Association between coronary artery disease polygenic risk score and the presence of migraine Results are given as odds ratios with 95% confidence.

Evolutionary genetics

Biology Today Third Edition

Cancer Evolution: No Room for Negative Selection

Genomic Signatures of Selective Pressures and Introgression from Archaic Hominins at Human Innate Immunity Genes Matthieu Deschamps, Guillaume Laval,

The Predecessors Within

CSIM2.4. Diagnosis 2 Dr. Moe Kyaw Thu

Understanding the Past

Analysis of A-to-I RNA edits found in transcriptome-wide RNA-seq

Fig. 1 Number of somatic mutations in representative human cancers, detected by genome-wide sequencing studies. Number of somatic mutations in representative.

Presentation transcript:

Credits to Vanessa Patel for some of the slides

 Archaeology – “the scientific study of material remains (as fossil relics, artifacts, and monuments) of past human life and activities”  Studies the time period starting at the Paleolithic time until the advent of literacy

 From bones, compared genomes of three different Neanderthals with five genomes from modern humans from different areas of the world Figure 1- R. E. Green et al., Science 328, (2010)

Stoneking, Krause, Nature Reviews Genetics 2011

Neutral Drift Positive Selection Negative Selection How can we detect negative selection? How can we detect positive selection?

Ka/Ks ratio: Ratio of nonsynonymous to synonymous substitutions Very old, persistent, strong positive selection for a protein that keeps adapting Examples: immune response, spermatogenesis Ka/Ks ratio: Ratio of nonsynonymous to synonymous substitutions Very old, persistent, strong positive selection for a protein that keeps adapting Examples: immune response, spermatogenesis

Less time: Fewer mutations Fewer recombinations