1 Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis) Stewart Cole

2 M. tuberculosis derived from M. bovis M. bovis M. tuberculosis Or was it? Proposed origin

3 Recent evolution of TB bacilli Proc. Natl. Acad. Sci. USA Vol. 94, pp , September 1997 Genetics Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination S. Sreevatsan, X. Pan, K.E. Stockbauer, N.D. Connell, B.N. Kreiswirth, T.S. Whittam AND J.M. Musser Section of Molecular Pathobiology, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA. Communicated by B.R. Bloom, Albert Einstein College of Medicine, Bronx, NY, July 4, 1997 (received for review May 6, 1997) ABSTRACTOne-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence IS6110 subtypes of this genetic group have IS6110 integrated at the identical chromosomal insertion site, located between dnaA and dnaN in the region containing the origin of replication. Remarkably, study of approximately 6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.

4 Genomics of tubercle bacilli M. tuberculosis complex AF2122/97Shotgun finished ShotgunH37Rv CDC1551 K- strain M. tuberculosisM. africanum M. canettii M. microti M. bovisM. bovis BCG BCG-Pasteur Finished In progress 4.41 Mb 4.32 Mb4.31Mb Shotgun

5 Maps of other spp. nearly identical 4,000 genes 40% orphans Genome of M. tuberculosis Cole et al. (1998) Nature 393:

6 Sources of genetic diversity Point mutations or SNP InDels Insertions: IS, gene dup, HT, replication errors Deletions: RecA, IS-mediated, replication errors Translocations PZA-R IS6110, BCG Common, RD None to date

7 Evolutionary Genomics of TB Bacilli

8 Comparative genomic statistics InDels drive plasticity TbD1: Major region of difference between Mt & Mb Garnier et al. (2003) PNAS 100:7877

9 TbD1 truncates MmpL6 ∆ M. tuberculosis Might affect lipid/glycolipid export

10 RD9 - an ancient deletion M. africanum M. microti BCG M. bovis AAATTACTGTGGCCCACGCCGGGCCGG M. tuberculosis Rv2073cRv2074Rv2075c..TTGGTGGCACGCCGGGCCGG AAATTACTGTGGCCCTGCGCAA.... cobL Cannot be due to insertion

M. tuberculosis H37Ra M. tuberculosis H37Rv Rv1758 ’ IS6110 RvD2-ORF1 RvD2-ORF2 RvD2-ORF3 plcD ’ Rv1758 ’ IR IS6110 Rv1758 ’ IS6110 IR IS6110 plcD ’ Rv1758 ’ IR Rv1758 M. bovis RvD2-ORF3 RvD2-ORF2 plcD RvD2-ORF1  GAGAGC GAG Less informative RvD2 - a recent deletion

12 RD regions in M. tb complex RD9 is here!

13 RD distribution in M. tbc M. tub.M. afri. M. mic. M. bov. BCG RD 9 RD3 (  Rv1) RD 9 RD 7 RD 8 RD 10 RD3 (  Rv1) RD 5’ RD 9 RD 7 RD 8 RD10 RD 4 RD 5 RD12 RD13 RD 9 RD 7 RD 8 RD10 RD 4 RD 5 RD12 RD13 RD 1 RD 2 RD3 (  Rv1) RD11 (  Rv2) M. can. TbD1 RD 12’

14 oxyR 285 G  A Common ancestor of the M. tuberculosis complex M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tuberculosis katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal- isol. oryx- isol. goat-isol. “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA 57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 Numerous sequence polymorphisms “modern” “ancestral” mmpL6 551 AAC  AAG Evolutionary scenario Brosch et al Proc Natl Acad Sci U S A. 99:

15 oxyR 285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal oryx goat “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA 57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 “modern” “ancestral” RD9 + mmpL6 551 AAC  AAG Rapid ID of TB bacilli

16 oxyR n285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal oryx goat “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA c57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 “modern” “ancestral” RD9 + TbD1 - mmpL6 551 AAC  AAG eg. Beijing cluster eg. Haarlem cluster eg. H37Rv Rapid ID of TB bacilli

17 oxyR n285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal-isolates oryx-isolates goat-isolates “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA c57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 “modern” “ancestral” RD9 - mmpL6 551 AAC  AAG Rapid ID of TB bacilli

18 oxyR n285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA 57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 “modern” “ancestral” RD9 - mmpL6 551 AAC  AAG mmpL6 551 AAG seal-isolates oryx-isolates goat-isolates Rapid ID of TB bacilli

19 oxyR n285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal oryx goat “classical” RD 1 BCG Tokyo gyrA 95 AGC  ACC pncA 57 CAC  GAC RD 4 RD 2 BCG Pasteur RD 14 TbD 1 “modern” “ancestral” RD9 - mmpL6 551 AAC  AAG RD4 - Rapid ID of TB bacilli

20 oxyR n285 G  A M. africanum RD 7 RD 8 RD 10 RD 12 RD 13 M. canettii RD 9 M. tub. katG 463 CTG  CGG M. microti M. bovis RD can RD mic RD seal seal oryx goat “classical” RD 1 BCG gyrA 95 AGC  ACC pncA 57 CAC  GAC RD 4 RD 2 RD 14 TbD 1 “modern” “ancestral” RD9 - mmpL6 551 AAC  AAG RD1 - Rapid ID of TB bacilli

21 Evolution of the M. tb complex M. bovis M. tuberculosis X

22 Progenitor bacillus M. bovis M. tuberculosis Evolution of the M. tb complex

23 Has M. tb evolved since? Different approaches to population genetics All based on genomics

24 Mycobacterium canettii is smooth M. tuberculosis M. canettii

25 Split decomposition analysis, SNP data MTBC (worldwide) Smooth tubercle bacilli (Djibouti, East Africa) M. canettii M. prototuberculosis

26 LSP (RD) typing Gagneux et al. (2006) Variable host-pathogen compatibility in M. tuberculosis. Proc Natl Acad Sci U S A; 103:

27 SNP typing - 1 Examined 37 sSNPs in 225 isolates Baker et al. (2004) Silent nucleotide polymorphisms and a phylogeny for Mycobacterium tuberculosis. Emerg Infect Dis 2004; 10:

28 SNP typing - 2 Gutacker et al. (2006) Single- nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. J Infect Dis; 193: sSNPs in 5069 isolates

29 SNP typing - 3 Studied 159 sSNPs in 219 isolates

30 Global distribution Red Euro-American Green W-African 1 Brown W-African 2 Yellow Indo-Oceanic Purple EA-Indian Blue East Asian Blue is most worrying

31 The Beijing family Appears to be more virulent, more transmissible & associated with MDR TRENDS in Microbiology Vol.10 No.1 January

32 Beijing phylogeny Marmiesse et al. (2004) Microbiology 150:

33 A new lipid - PGL - in Beijing Reed et al. (2004) Nature 431: 84-87

34 Effect of PGL on virulence Reed et al. (2004) Nature 431: Immunocompetent mice, aerosol infection

35 Immunologic effects of PGL Reed et al. (2004) Nature 431: 84-87

36 Further immunologic effects Reed et al. (2004) Nature 431: Single sugar accounts for difference

37 PGL impacts on phenotype Reed et al. (2004) Nature 431: Increases lethality greatly but not bacterial load Down-regulates pro-inflammatory response in dose-dependent manner Represses TNF-alpha, IL-6 & IL-12 production May contribute to increased transmission

38 Summary  M. tuberculosis complex tightly knit but differences in host range  M. tuberculosis not descended from M. bovis but possibly from M. prototuberculosis  Species became host adapted. 4-5 major M.tb groups  Hypervirulent variants emerge and replace existing clones

39 With the participation of... ILEP Institut Pasteur R. Brosch S. Brisse M-C. Gutierrez T. Garnier N. Honoré M. Marmiesse V. Vincent WT Sanger Institute B.G. Barrell J. Parkhill M-A. Rajandream Central Veterinary Lab. R.G. Hewinson S.V. Gordon NIH NIAID