Understanding the Etiology of Premature Rupture of Membranes Amy P. Murtha, MD Vice Chair for Research Obstetrics and Gynecology

Preterm Birth  Preterm birth defined as delivery prior to 37 weeks gestation  11.9% of all deliveries in the US  500,000 pregnancies in the US per year  More than newly diagnosed breast cancer cases

Preterm Birth in the US Year Late preterm ( weeks) Early preterm (< 34 weeks) Preterm (< 37 weeks) 2011

Preterm Birth in the US Relative to the World – WHO Data* CountryPreterm Birth Rates Africa11.9 North America10.6 Asia9.1 Central America9.1 South America7.9 Australia/New Zealand6.4 Europe6.2 *Beck et al 2010:

Preterm Birth in North Carolina National Center for Health Statistics, Final Natality Data

Preterm PROM  Rupture of membranes prior to 37 weeks without labor  2-3% of all pregnancies are result of PPROM  20% of all perinatal deaths

PPROM Management  weeks Delivery  <34 weeks Admitted for duration of pregnancy  Monitored for evidence of infection or labor  Clinical detection of infection limited  Maternal fever increases risk of neonatal morbidity

Research Objectives  Impact the management of PPROM  Understand the etiology of PPROM

Biomarkers of Intrauterine Infection  Prospective cohort study daily blood samples monitored for infection received antibiotics and steroids  Subjects divided into those with and without funisitis (infection in umbilical cord)

PPROM Study Funisitis N=54 No Funisitis N=53 P value % Clinical Chorioamnionitis 22/54 (41%)1/49 (2%)<.0001 GA at delivery (wks) mean (SD) 28.5 (3.2)31.5 (2.6)<.0001 Birthweight (grams)1182 (516)1716 (547)<.0001 PPROM to delivery interval (mean days) 12.7 (10.3)16.4 (14.7).11

Median Serum IL-6 (pg/mL) Time pointFunisitis No FunisitisP value hours7.5 (1.8–48.5) 2.8 (0.0–9.6) < hours5.3 ( ) 1.5 ( ) <.0001 >72 hours2.9 ( ) 1.8 ( ) hours5.3 ( ) 1.9 ( ) <.0001

Infection and Inflammation in Pregnancy Blood and Tissue Repository  Over 400 subjects enrolled with over 4,000 samples collected 140 complete sets with daily blood samples collected  Detailed delivery samples collected, barcoded and stored Maternal and cord blood, placenta, fetal membranes, umbilical cord, buccal swab

Understanding the Etiology of PPROM  Mechanisms resulting in membrane thinning (weakening)  Focus on the chorion cell layer Amnion Chorion Decidua

Etiology of PPROM  Poorly understood and difficult to study  Infection and inflammation important in development of PPROM

Fetal Chorion Layer  Accelerated apoptosis in chorion layer Preterm and term in presence of histologic chorioamnionitis 1  Thinned or absent chorion among PPROM subjects 2 1 Murtha AP et al. Infect Dis Obstet Gynecol 2002;10:93–96 2 George RB et al. Am J Perinatol 2008;25:29–32

PPROM and the Chorion Amnion Chorion Amnion Chorion absent Normal PPROM

Moving forward…prospective collection Fetal membrane chorion thickness at membrane rupture distant from rupture  Bacterial presence in fetal membranes membrane rupture distant from rupture  Primary cell culture and cell line

Methods – Data Collection  46 paired membrane samples collected Rupture site (rupture) or overlying cervix Distant to rupture site (distant)

IHC Methods – Sample Processing  Chorion and choriodecidual thickness measured using Image J ® software Chorion Choriodecidua

FISH Methods – Sample Processing  Bacteria identified using fluorescence in situ hybridization (FISH) with Alexa Red probe to 16s rRNA subunit Custom oligonucleotide sequence 5´-F- ACTGCTGCCTCCCGTAGGAGTTTATTCCTT (Invitrogen®)

DistantRupture Chorion Term, No Labor 10X magnification

Distant Chorion Rupture PPROM 10X magnification

Chorion Thickness by Clinical Group Mean Thickness (µm) * ^ * P = ^ P =

Number of Bacteria per Membrane Quadrant by Clinical Group *P < ^P = Number Bacteria Per Quadrant ^ *

Number Bacteria per Membrane Quadrant Without Chorioamnionitis Number Bacteria Per Quadrant *P = 0.03^P = N = 7N = 14N = 16 ^ *

What else….  Bacterial DNA sequencing from fetal membranes  Ureaplasma parvum as a pathogen in pregnancy  Thrombin’s role in fetal membrane integrity  Cigarette smoke exposure and effect on membranes and placenta  Progesterone’s role in modulating the inflammatory response  MMP activity and regulation of progesterone  Mechanisms of progesterone function through non- nuclear PR (PGRMC1)

Clinical Research in OB/GYN  MFMU Clinical Trials Network (Federal)  Antenatal Late Preterm Steroids (ALPS): A Randomized Placebo-Controlled Trial  DMID vaccine trials (Federal)  National Children’s study (Federal)  Newborn Epigenetic Study (NEST) (Federal)  Children’s Environmental Health Initiative (Federal)  17OH PC for Prevention of Recurrent Preterm Birth (Industry)  Labor induction with misoprostil (Industry)  Wound Vac in Obesity (Industry)  Prenatal diagnosis with Maternal free fetal DNA (Federal/Industry)  The effects of SCDs on fibrinolysis in patients undergoing Cesarean Delivery (Industry)  A Prospective Study of the Hemostatic Differences between Women with and without Vaginal Bleeding in Pregnancy (Federal)  An Intervention to Maximize Research Sample Collection for Pregnant Subjects at Delivery (Duke)  Comparing Focused Ultrasound and Uterine Artery Embolization for Uterine Fibroids (Federal)  Bridging Interdisciplinary Research Careers in Women’s Health (BIRCWH) K23 (Federal)   Pelvic Floor Clinical Trials Network (Federal)   Management of Menorrhagia in Women with Bleeding Disorders (Federal)   Neural Prosthetic Control of Continence and Micturition (Federal)   Effectiveness Of Sacrospinous Ligament Fixation (SSLF) versus Uterosacral Ligament Suspension (Federal)   Cervical Intraepithelial Neoplasia Cohort Study (Federal)   Ambulatory Treatments for Leakage Associated with Stress (Federal)   Anticholinergic vs. Botox Comparison study: The ABC Trial (Federal)   Outcomes Following Vaginal Prolapse Repair and Mid Urethral Sling (OPUS) Trial (Federal)   Prospective randomized study of sperm production in healthy volunteers receiving pregabalin or placebo. (Federal/Industry)   GIS Health Data in the Blanchard Neighborhood of Haiti: Assessment of Community Needs Guide Community Public Health Practice? (Foundation)   Molecular Markers of Human Sperm Function (Federal)

Questions?