2 Protein Targeting pathways Protein synthesis always begins on free ribosomes In cytoplasm 1) Post -translational: proteins of plastids, mitochondria,

Slides:



Advertisements
Similar presentations
Endomembrane System Protein Sorting and Transportation Shantou University Medical College Liu Gefei ( 刘戈飞 )
Advertisements

Transfer 5 µl from your PCR tube to fresh tube, add 1 µl dye & run on 0.7% gel.
Lesson 3: Translation.
1 CA García Sepúlveda MD PhD Tema 12 Localización y translocación proteica Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad Autónoma.
Intracellular Transport1 Chapter 15 You should review functions of different organelles We already discussed evolution; review Focus will be on: 1) mechanisms.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Cell and Molecular Biology Behrouz Mahmoudi Cell Organelles-1 1.
Roadmap of protein traffic inside cell.
Chapter 26 Protein Sorting. Chapter Objectives Understand the pathways of cotranslational processing of proteins – ER, Golgi, Plasma membrane, Lysosomes.
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
1.Set up 110 µl mix for each primer/DNA combo on ice! µl 100x F primer (1 pMol/µl = 1µM final []) µl 100x R primer 3.11 µl 10x PCR buffer
Post-Translational Events I Translocation of Newly Synthesized Proteins into Membranous Organelles.
Fundamentals of Cell Biology Chapter 8: Protein Synthesis and Sorting.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
PROTEIN TRAFFICKING AND LOCALIZATION PROTEINS SYNTHESIZED IN CYTOPLASM, BUT BECOME LOCALIZED IN CYTOPLASM CYTOPLASMIC MEMBRANE PERIPLASM OUTER MEMBRANE.
Translation Translation is the process of building a protein from the mRNA transcript. The protein is built as transfer RNA (tRNA) bring amino acids (AA),
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Part 1: Intracellular trafficking Week 1: Transport through the nuclear pore complex Week 2: RNA transport, maturation & localization Week 3: ER translocation.
Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!
Part 1: Intracellular trafficking Week 1: Transport through the nuclear pore complex Week 2: RNA transport, maturation & localization Week 3: ER translocation.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Chemical reactions in cells need to be isolated. Enzymes work in complexes, spatial distribution in cytosol, nucleus Confinement of reactions in organelle.
Lecture 6 - Intracellular compartments and transport I.
Step 2 of Protein Synthesis
Protein synthesis decodes the information in messenger RNA
ROUGH ENDOPLASMIC RETICULUM
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
1 CA García Sepúlveda MD PhD Protein Localization, Translocation & Trafficking Laboratorio de Genómica Viral y Humana Facultad de Medicina, Universidad.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
How do proteins fold? Folding in a test-tube The structure of proteins is determined by the amino acid sequence; many proteins in solution can be unfolded.
Chapter 3 Membrane targeting of proteins By D. Thomas Rutkowski & Vishwanath R. Lingappa.
Protein targeting to organelles 1.From the birth place to the destination— general principles 1)The problem: One place to make protein but many destinations—how.
Cellular compartmentalization Pages Q1 Name at least two of the three protein complexes involved in the electron transport chain?
Molecular and Cellular Biochemistry 2. ER- protein modifications
Pick one of the papers listed at Prepare a 10’-15’ journal club about it for March 16.
© 2003 By Default!Slide 1 Protein Sorting, Transport and modification part1 M. Saifur Rohman, MD, PhD, FIHA.
Molecular Cell Biology
MOLECULAR CELL BIOLOGY SIXTH EDITION MOLECULAR CELL BIOLOGY SIXTH EDITION Copyright 2008 © W. H. Freeman and Company CHAPTER 13 Moving Proteins into Membranes.
Chapte r 8 Protein localization. 8.1 Introduction 8.2 Chaperones may be required for protein folding 8.3 Post-translational membrane insertion depends.
Bridget, Jephte, Kristi, Matt, Teresa 1.Set up 20 µl mix for each primer/DNA combo on ice! 1.2 µl 10x F primer (1 pMol/µl = 1µM final []) 2.2 µl 10x R.
Endomembrane System Yasir Waheed NUST Center of Virology & Immunolgy National University of Sciences &Technology.
Lodish Berk Kaiser Krieger Scott Bretscher Ploegh Matsudaira MOLECULAR CELL BIOLOGY SIXTH EDITION CHAPTER 13 Moving Proteins into Membranes and Organelles.
LECT 20: PROTEIN SYNTHESIS AND TRANSLATIONAL CONTROL High fidelity of protein synthesis from mRNA is essential. Mechanisms controling translation accuracy.
ER and Golgi: Working Together! Mr. Nichols PHHS.
RNA Directed Synthesis of a Polypeptide
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
Pg. 367.
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Molecular Biology of the Cell
Chapter 12 Intracellular Compartments and Protein Sorting.
Conference on RER, Golgi, and secretion
PACKAGING, TRANSPORTING and EXPORTING
 The endoplasmic reticulum (ER) in the cells of eukaryotic organisms is an interconnected network of flattened, membrane-enclosed sacs or tubes known.
Membrane Transport A Thermodynamic Perspective
Cell Biology & Biochemistry Series : Set 4 Version: 1.0.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Protein targeting or Protein sorting Refer Page 1068 to 1074 Principles of Biochemistry by Lehninger & Page 663 Baltimore Mol Cell Biology.
Protein degradation rate varies 100x
4-1 Protein Synthesis Is a Major Function of Cells.
Post-Translational Events I Protein Trafficking
Protein Localization Chapter Introduction Figure 10.1.
Protein Synthesis and Sorting: A Molecular View
Protein Sorting & Transport
Pick one of the papers listed at
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
Intracellular Compartments and Transport
Termination of Translation
Next Assignment: Wed April 17
Presentation transcript:

2 Protein Targeting pathways Protein synthesis always begins on free ribosomes In cytoplasm 1) Post -translational: proteins of plastids, mitochondria, peroxisomes and nuclei 2) Endomembrane system proteins are imported co-translationally

2 pathways for Protein Targeting 1) Post -translational 2) Co-translational: Endomembrane system proteins are imported co-translationally inserted in RER as they are made transported to final destination in vesicles

SIGNAL HYPOTHESIS Protein synthesis begins on free ribosomes in cytoplasm endomembrane proteins have "signal sequence"that directs them to RER “attached” ribosomes are tethered to RER by the signal sequence

SIGNAL HYPOTHESIS Protein synthesis begins on free ribosomes in cytoplasm Endomembrane proteins have "signal sequence"that directs them to RER SRP (Signal Recognition Peptide) binds signal sequence when it pops out of ribosome & swaps GDP for GTP

SIGNAL HYPOTHESIS SRP stops protein synthesis until it binds “docking protein”(SRP receptor) in RER Ribosome binds Translocon & secretes protein through it as it is made BiP (a chaperone) helps the protein fold in the lumen

Subsequent events Simplest case: 1) signal is cleaved within lumen by signal peptidase 2) BiP helps protein fold correctly 3) protein is soluble inside lumen

Subsequent events Complications: proteins embedded in membranes

proteins embedded in membranes protein has a stop-transfer sequence too hydrophobic to enter aqueous lumen

proteins embedded in membranes protein has a stop-transfer sequence too hydrophobic to enter lumen therefore gets stuck in membrane ribosome releases translocon, finishes job in cytoplasm

More Complications Some proteins have multiple trans-membrane domains (e.g. G-protein-linked receptors)

More Complications Explanation: combinations of stop-transfer and internal signals -> results in weaving the protein into the membrane

Sorting proteins made on RER Simplest case: no sorting proteins in RER lumen are secreted

Sorting proteins made on RER Simplest case: no sorting proteins in RER lumen are secreted embedded proteins go to plasma membrane

Sorting proteins made on RER Redirection requires extra information:

Sorting proteins made on RER Redirection requires extra information: 1) specific motif 2) receptors

Sorting proteins made on RER ER lumen proteins have KDEL (Lys-Asp-Glu-Leu) motif Receptor in Golgi binds & returns these proteins ER membrane proteins have KKXX motif

Sorting proteins made on RER Golgi membrane proteins cis- or medial- golgi proteins are marked by sequences in the membrane-spanning domain trans-golgi proteins have a tyrosine-rich sequence in their cytoplasmic C-terminus

Sorting proteins made on RER Plant vacuolar proteins are zymogens (proenzymes) signal VTS Barley aleurain Barley lectin mature protein

Sorting proteins made on RER Plant vacuolar proteins are zymogens (proenzymes), cleaved to mature form on arrival targeting motif may be at either end of protein signal VTS Barley aleurain Barley lectin mature protein

Sorting proteins made on RER lysosomal proteins are targeted by mannose 6-phosphate M 6-P receptors in trans-Golgi direct protein to lysosomes (via endosomes) M 6-P is added in Golgi by enzyme that recognizes lysosomal motif

Glycosylation within ER All endomembrane proteins are highly glycosylated on lumenal domains. Glycosylation starts in the ER, continues in the Golgi

Glycosylation within ER All endomembrane proteins are highly glycosylated on lumenal domains. Glycosylation starts in ER, continues in Golgi makes proteins more hydrophilic essential for proper function tunicamycin poisons cells Glycosylation mutants are even sicker

Glycosylation in RER remove 2 glucose & bind to chaperone If good, remove gluc 3 & send to Golgi If bad, GT adds glucose & try again Eventually, send bad proteins to cytosol & eat them

Post-translational protein targeting Key features 1) imported after synthesis

Post-translational protein targeting Key features 1) imported after synthesis 2) targeting information is motifs in protein a) which organelle b) site in organelle 3) Receptors guide it to correct site 4) no vesicles!

Protein targeting in Post-translational pathway SKL (ser/lys/leu) at C terminus targets most peroxisomal matrix proteins = PTS1 In humans 3 are targeted by 9 aa at N terminus = PTS2 Defective PTS2 receptor causes Rhizomelic chondrodysplasia punctata N C SKL N C PTS2

Targeting peroxisomal proteins Bind receptor in cytoplasm Dock with peroxisomal receptors Import protein w/o unfolding it! Recycle receptors

Peroxisomal Membrane Synthesis Most peroxisomes arise by fission can arise de novo! Mechanism is poorly understood/ may involve ER! Only need PEX 3 & PEX 16 to import pex membrane prot

Protein import into nuclei nuclear proteins are targeted by internal motifs necessary & sufficient to target cytoplasmic proteins to nucleus

Protein import into nuclei nuclear proteins are targeted by internal motifs as in golgi, are not specific shapes cf sequences Receptors bind objects of the right shape!

Protein import into nuclei 3 types of NLS (nuclear localization sequence) 1) basic residues in DNA-binding region LZ

Protein import into nuclei 3 types of NLS (nuclear localization sequence) 1) basic residues in DNA-binding region 2) SV-40 KKKRK KKKRK LZ

Protein import into nuclei 3 types of NLS (nuclear localization sequence) 1) basic residues in DNA-binding region 2) SV-40 KKKRK 3) bi-partite: 2-4 basic aa,10-20 aa spacer, 2-4 basic aa KKKRK LZ +

Protein import into nuclei 1) importin  binds NLS importin  binds complex 2) escort to nuclear pores Pores decide who can enter/exit nucleus

Protein import into nuclei 1) importin  binds NLS, importin  binds complex 2) escort to nuclear pores 3) transporter changes shape, lets complex enter 4) nuclear Ran-GTP dissociates complex 5) Ran-GTP returns  importin  to cytoplasm, becomes Ran-GDP. GTP -> GDP = nuclear import energy source 6) Exportins return  importin  & other cytoplasmic prot