Regulation of Gene Expression I 4/15/2017 Scotty Merrell Department of Microbiology and Immunology B4140 dmerrell@usuhs.mil Regulation of Gene Expression I

QUESTIONS 1. Why does the expression of genes need to be regulated? 4/15/2017 QUESTIONS 1. Why does the expression of genes need to be regulated? 2. Why is it important to study gene regulation? 3. How is the expression of genes regulated? 4. How do we study gene regulation?

Bacteria experience different conditions depending on environment 4/15/2017 Pathogenic bacteria: External reservoir Host Infection site #1 Infection site #2

QUESTIONS 1. Why does the expression of genes need to be regulated? 4/15/2017 QUESTIONS 1. Why does the expression of genes need to be regulated? 2. Why is it important to study gene regulation? 3. How is the expression of genes regulated? 4. How do we study gene regulation?

Pathogenic bacteria produce virulence factors when they sense they are inside of a host 4/15/2017 ICDDR,B Vibrio cholerae, the cause of cholera, produces toxin inside of the host. Understanding regulation of expression of this toxin is a means of understanding ways to prevent its production.

QUESTIONS 1. Why does the expression of genes need to be regulated? 4/15/2017 QUESTIONS 1. Why does the expression of genes need to be regulated? 2. Why is it important to study gene regulation? 3. How is the expression of genes regulated? 4. How do we study gene regulation?

Regulation of Gene Expression 4/15/2017

Regulation of Gene Expression 4/15/2017

4/15/2017

RNA polymerase-promoter interactions 4/15/2017 RNA polymerase-promoter interactions Some promoters contain UP elements that stimulate transcription through direct interaction with the C-terminal domains of the  subunits of the RNA polymerase

Arrangement of a subunits on UP elements 4/15/2017 Promoter with a full UP element containing two consensus subsites. Promoter with an UP element containing only a consensus proximal subsite. Promoter with an UP element containing only a consensus distal subsite.

Genes come in two main flavors: 4/15/2017 Genes come in two main flavors: Constitutively expressed (transcription initiation is not regulated by accessory proteins) Regulated (transcription initiation is regulated by accessory proteins) a. Negatively Regulated--Repressor Protein b. Positively Regulated--Activator Protein

Mechanisms of Regulation of Transcription Initiation: Negative Regulation 4/15/2017 RNA Polymerase

Mechanisms of Regulation of Transcription Initiation: Negative Regulation 4/15/2017 Repressor Co-repressor Inactivator Repressor Repressor

a model for negative regulation The lac operon a model for negative regulation 4/15/2017 A bacterium's prime source of food is glucose, since it does not have to be modified to enter the respiratory pathway. So if both glucose and lactose are around, the bacterium wants to turn off lactose metabolism in favor of glucose metabolism. There are sites upstream of the lac genes that respond to glucose concentration. This assortment of genes and their regulatory regions is called the lac operon.

4/15/2017

4/15/2017

4/15/2017

The lac promoter and operator regions 4/15/2017

prevents transcription The Lac Repressor is constitutively expressed 4/15/2017 Lac Repressor (monomer) (tetramer) Repressor binding prevents transcription

the cell and binds to the Lac repressor, inducing a conformational When lactose is present, it acts as an inducer of the operon. It enters the cell and binds to the Lac repressor, inducing a conformational change that allows the repressor to fall off the DNA. Now the RNA polymerase is free to move along the DNA and RNA can be made from the three genes. Lactose can now be metabolized. 4/15/2017 Remember, the repressor acts as a tetramer

When the inducer (lactose) is removed, the repressor returns to its original conformation and binds to the DNA, so that RNA polymerase can no longer get past the promoter to begin transcription. No RNA and no protein are made. 4/15/2017 Remember, the repressor acts as a tetramer

How to identify the regulatory elements? 4/15/2017 How to identify the regulatory elements? 1. Mutation in the regulatory circuit may either abolish expression of the operon or cause it to occur without responding to regulation. 2. Two classes of mutants: A. Uninducible mutants: mutants cannot be expressed at all. B. Constitutive mutants: mutants continuously express genes that do not respond to regulation. 3. Operator (lacO): cis-acting element Repressor (lacI): trans-acting element

Definitions: cis-configuration: description of two sites on the same 4/15/2017 cis-configuration: description of two sites on the same DNA molecule (chromosome) or adjacent sites. cis dominance: the ability of a gene to affect genes next to it on the same DNA molecule (chromosome), regardless of the nature of the trans copy. Such mutations exert their effect, not because of altered products they encode, but because of a physical blockage or inhibition of RNA transcription. trans-configuration:description of two sites on different DNA molecules (chromosomes) or non-contiguous sites.

Constitutive mutants: do not respond to regulation. 4/15/2017 Would this be a cis-dominant or recessive mutation?

Constitutive mutants can be recessive 4/15/2017 Constitutive mutants can be recessive

Constitutive mutants can also be dominant if the mutant allele produces a “bad” subunit, which is not only itself unable to bind to operator DNA, but is also able to act as part of a tetramer to prevent any “good” (wild type LacI) subunits from binding. 4/15/2017 Pi lacI- P O lacZ lacY lacA X mRNA mRNA et al. mRNA lacI +

Think about how you could determine whether a mutation was dominant or 4/15/2017 Think about how you could determine whether a mutation was dominant or recessive.

Questions about negative 4/15/2017 Questions about negative Regulation of lac ?

Mechanisms of Regulation of Transcription Initiation: Positive Regulation 4/15/2017 RNA Polymerase

Mechanisms of Regulation of Transcription Initiation: Positive Regulation 4/15/2017 RNA Polymerase Activator

a model for positive regulation The lac operon a model for positive regulation 4/15/2017 When levels of glucose (a catabolite) in the cell are high, a molecule called cyclic AMP is inhibited from forming. So when glucose levels drop, more cAMP forms. cAMP binds to a protein called CAP (catabolite activator protein), which is then activated to bind to the CAP binding site. This activates transcription, perhaps by increasing the affinity of the site for RNA polymerase. This phenomenon is called catabolite repression, a misnomer since it involves activation, but understandable since when it was named, it seemed that the presence of glucose repressed all the other sugar metabolism operons.

CAP --- a positive regulator 4/15/2017 CAP --- a positive regulator 1. Catabolite repression: the decreased expression of many bacterial operons that results from addition of glucose. Also known as “glucose effect” or “glucose repression”. 2. E. coli catabolite gene activator protein (CAP; also known as CRP, the cAMP receptor protein). 3. CAP-cAMP activates more than 100 different promoters, including promoters required for utilization of alternative carbohydrate carbon sources such as lactose, galactose, arabinose, and maltose.

4/15/2017

How does glucose reduce cAMP level? 4/15/2017 How does glucose reduce cAMP level? PTS Glucose Glucose-6-P IIAGlc-P IIAGlc OUT IN PTS - phosphoenolpyruvate-dependent carbohydrate phosphotransferase system IIAGlc - glucose-specific IIA protein, one of the enzymes involved in glucose transport. 1. IIAGlc-P activates adenylate cyclase. 2. Glucose decreases IIAGlc-P level, thus reducing cAMP production. 3. Glucose also reduces CAP level: crp gene is auto-regulated by CAP-cAMP.

Activation of expression of the lac operon 4/15/2017

E. coli CAP (CRP) --- 209 amino acids 4/15/2017 E. coli CAP (CRP) --- 209 amino acids DNA-binding Helix-turn-helix Dimerization and cAMP-binding 1-139 140-209 NH2- AR1 -COOH 156-164 His19 His21 Glu96 Lys101 AR2

Transcription activation by CAP at class I CAP-dependent promoters 4/15/2017 (-62) Transcription activation: Interaction between the AR1 of the downstream CAP subunit and one copy of aCTD. The AR1-aCTD interaction facilitates the binding of aCTD to the DNA downstream of CAP. Possibly, interaction between same copy of aCTD and the s70 bound at the –35 element. 4. The interaction between the second aCTD and CAP is unclear. The result: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant KB, for the formation of the RNAP-promoter closed complex

Transcription activation by CAP at class I CAP-dependent promoters (cont.) 4/15/2017 (-103, -93, -83, or –72) Transcription activation: Possibly, the second copy of aCTD may interact with the DNA downstream of CAP, and may interact with the s70 bound at the –35 element. Results: increasing the affinity of RNAP for promoter DNA, resulting in an increase in the binding constant KB, for the formation of the RNAP-promoter closed complex

Transcription activation by CAP at class II CAP-dependent promoters (cont.) 4/15/2017 (-42) Transcription activation: Interaction between the AR1 of the upstream CAP subunit and one copy of aCTD (either aCTDI or aCTDII, but preferentially aCTDI). The AR1-aCTD interaction facilitates the binding of aCTD to the DNA upstream of CAP. Results: increase in the binding constant KB, for the formation of the RNAP-promoter closed complex Interaction between the AR2 of the downstream CAP subunit and aNTDI. Result: increase the rate constant, kf, for isomerization of closed complex to open complex.

Transcription activation by CAP at class III CAP-dependent promoters 4/15/2017 (-103 or –93) (-62) Transcription activation: Each CAP dimer functions through a class I mechanism with AR1 of the downstream subunit of each CAP dimer interacting with one copy of aCTD Results: synergistic transcription activation

Transcription activation by CAP at class III CAP-dependent promoters (cont.) 4/15/2017 (-103, -93, or -83) (-42) Transcription activation: The upstream CAP dimer functions by a class I mechanism, with AR1 of the downstream subunit interacting with one copy of aCTD; the downstream CAP dimer functions by a class II mechanism, with AR1 and AR2 interacting with the other copy of aCTD and aNTD, respectively. Results: synergistic transcription activation

No lactose inside the cells! 4/15/2017 (a) Glucose present (cAMP low); no lactose; (b) Glucose present (cAMP low); lactose present lacI Pi P O lacY lacZ lacA Repressor monomer tetramer mRNA X No lactose inside the cells! (inducer exclusion)! Repressor monomer tetramer mRNA Inducer High level of mRNA X Inactive repressor High (c) No glucose (cAMP high); lactose present cAMP CAP Glucose effect on the E. coli lac operon

No lactose inside the cells! 4/15/2017 (a) Glucose present (cAMP low); no lactose; (b) Glucose present (cAMP low); lactose present lacI Pi P O lacY lacZ lacA Repressor monomer tetramer mRNA X No lactose inside the cells! (inducer exclusion)! Repressor monomer tetramer mRNA Inducer High level of mRNA X Inactive repressor High (c) No glucose (cAMP high); lactose present cAMP CAP Glucose effect on the E. coli lac operon

Inducer exclusion: How does it work? 4/15/2017 Uptake of glucose dephosphorylates enzyme IIglc. Dephosphorylated enzyme IIglc binds to and inhibits lactose permease. Inhibition of lactose permease prevents lactose from entering the cell. Hence, the term inducer exclusion.

Questions about positive regulation 4/15/2017 Questions about positive regulation of the lac operon?

Dual positive and negative control of transcription initiation: 4/15/2017 Dual positive and negative control of transcription initiation: the E. coli ara operon

The E. coli L-arabinose operon 4/15/2017 The E. coli L-arabinose operon + +

AraC exists in two states 4/15/2017 Arabinose P1 P2 Antiactivator Activator Arabinose

AraC acts as a positive or negative regulator based on its conformational state and binding affinity for various sites in the two promoter regions. 4/15/2017 AraC encodes the regulator AraO1 and AraO2 encode operators CAP is a CAP binding site AraI is an additional regulatory region AraBAD are the structural genes

In the absence of arabinose, the P1 form of AraC binds AraO2 and AraI to prevent any P2 form from binding and activating expression --this is anti-activation, not repression! 4/15/2017 No arabinose + arabinose In the presence of arabinsose, AraC shifts to the P2 form and binds AraI and acts to activate transcription. If AraC concentration becomes too high, AraC will also bind to AraO1 and repress its own expression. Therefore AraC is an Activator, Repressor and Anti-activator!!

The domain structure of one subunit of the dimeric AraC protein 4/15/2017 The regulatory regions of the PC and PBAD promoters The domain structure of one subunit of the dimeric AraC protein

The PC and PBAD Regions in the presence or absence of arabinose 4/15/2017 The PC and PBAD Regions in the presence or absence of arabinose + L-arabinose

Hypothetical model of the activation of the PBAD promoter 4/15/2017 Hypothetical model of the activation of the PBAD promoter PBAD – class II promoter Possible interactions: between the aCTD of RNAP and the CAP protein and AraC protein and DNA

Strategies for Understanding Regulation 4/15/2017 Strategies for Understanding Regulation 1. Find mutations that render the regulation uninducible or constitutive. 2. Decide by performing a complementation test if the mutants are dominant or recessive. 3. If they are recessive, decide if the system is regulated by repression or by activation. A recessive mutated activator has most likely lost function: the system will become uninducible. A recessive mutated repressor has also lost function, but now the system will show constitutive expression. 4. Decide if the elements of the system act in cis or in trans to each other: are they proteins or DNA binding sites? 5. Construct a model.

Questions about ara regulation? 4/15/2017 Questions about ara regulation?

A. Transcriptional control 1. Transcription initiation a) Positive 4/15/2017 Regulatory mechanisms used to control gene expression A. Transcriptional control 1. Transcription initiation a) Positive b) Negative 2. Transcription termination Attenuation B. Translational control 1. Positive 2. Negative C. Post-translational control--Proteolysis

4/15/2017

Transcription termination players: and sometimes the Rho (r) factor 4/15/2017 Transcription termination players: Termination sequence RNA polymerase and sometimes the Rho (r) factor RNAP A B C D X Promoter Operon of 4 genes Terminator

Two major types of Terminator Sequences 1. Rho-independent 2. Rho-dependent 4/15/2017 Rho-independent terminator Rho-independent terminator Rho-dependent terminator

Premature termination of transcription 4/15/2017 Attenuation: Premature termination of transcription of operons for amino acid biosynthesis (trp, his, leu, etc.) Bacterial version of Supply and Demand Relies on coupled transcription and translation and RNA secondary structure

Organization of Tryptophane Biosynthesis Genes 4/15/2017 Organization of Tryptophane Biosynthesis Genes End product of the pathway The trp leader mRNA encodes the LEADER PEPTIDE MetLysAlaIlePheValLeuLysGlyTrpTrpArgThrSer 5’-AUGAAAGCAAUUUUCGUACUGAAAGGUUGGUGGCGCACUUCC U CCCAUAGACUAACGAAAUGCGUACCACUUAUGUGACGGGCAAAG A GCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGA-3’ 1 3 2 4

mRNA forms secondary structures 4/15/2017 1 2 3 4 Pre-emptor 2 and 3 form the Pre-emptor, which prevents Terminator formation 3 and 4 form a Rho-independent terminator Two possible alternative structures can form 2 is complementary to 1 and 3 3 is complementary to 2 and 4 Adapted from http://www.andrew.cmu.edu/user/berget/Education/attenuation/atten.html

4/15/2017 Tryptophan absent Tryptophan present

4/15/2017

Attenuation can also occur at the level of Protein-RNA interaction: 4/15/2017 Attenuation can also occur at the level of Protein-RNA interaction: Regulation of the trp operon in Bacillus

Model of trp transcriptional control Binding of activated TRAP 4/15/2017 Binding of activated TRAP in the leader peptide results in the formation of a terminator structure

Transcription of genes to produce mRNA 4/15/2017 Take home message: Transcription of genes to produce mRNA can be controlled at the level of initiation and/or termination

4/15/2017 STOP