Regents Lab Review

Diffusion and Osmosis Designed to help you understand the concepts of Diffusion and Osmosis and how these cell processes effect the cell; Designed to help you understand the concepts of Diffusion and Osmosis and how these cell processes effect the cell; Define: diffusion, osmosis, hypertonic, isotonic, hypotonic, saline, selectively permeable, molecule size; Define: diffusion, osmosis, hypertonic, isotonic, hypotonic, saline, selectively permeable, molecule size;

Part 1: Diffusion Diffusion: movement of molecules from an area of high concentration to an area of low concentration along the concentration gradient. Example is when you put your Lugol’s solution into the water and the water began to turn the “rust/tea” color. Before diffusion occurs… After diffusion occurs…

Part 2: Create a “cell” Soak 10 inches of dialysis tubing; Tie knot in one end; Put 10mL of glucose solution in and 20mL of starch solution in; Pinch/clamp closed and put into cellular environment (Lugol’s and water) for 15 minutes; Observe the changes and infer what happened Insert into “cellular environment” Wait about 15 minutes and observe.

After 15 minutes, observe… What happened to the glucose in the “cell”? …the starch in the “cell”? …the Lugol’s iodine outside the “cell”? Why? Starch solution (S) Iodine solution (I) Glucose solution (G) G S I I G S I I G G G G S S At the beginning…After 15 minutes… I I I I

And now, the part that makes you cry (ok, not really, but the “Red Onion” part of the lab)… Prepare a wet mount slide of the inner epidermis of a red onion section; Observe the red onion and draw what you see; Add a couple of drops of saline (salt) solution to the epidermis. Wait 5 minutes; Observe under microscope again, note any changes; Add freshwater to the slide, wait 5 minutes, observe changes again.

Red Onion Plasmolysis Observation Before and after observations of red onion epidermis under the microscope (400X) Red onion under in isotonic (normal) solution. Note cell membrane and cytoplasm almost completely “fill” the boundary of the cell wall. Red onion under in hypertonic (salt) solution. Note cell membrane has “withdrawn” and the cytoplasm has lost water to the salty environment, making it appear smaller and darker.

The Beaks of Finches NYSED Lab

What is the “goal” of the lab? Demonstrate how Darwin’s Finches (those that he observed on the Galapagos Islands) have adapted new beaks yet remain similar to the shared common ancestor that most likely came from the mainland. Demonstrate how Darwin’s Finches (those that he observed on the Galapagos Islands) have adapted new beaks yet remain similar to the shared common ancestor that most likely came from the mainland.

Required Supplies for “B of F” A randomly assigned “beak” Timer Petri dish Small seed island Large seed island

Round 1 Only one seed at a time may be eaten. To be “eaten” it must land inside your stomach. If you scoop seeds or eat more than one at a time, you “choke” and vomit all of your seeds out. Average is taken from four trials, 60 seconds each.

And now, Round 1… Seeds Collected Partner #1Trial #1 Partner #1Trial #2 Partner #2Trial #3 Partner #2Trial #4 Average Did you average over 13 seeds? YESNO Go to Round 2 Increased Competition Repeat Round 1 on the “big seed” island with the same beak

Successful in Round 1? Welcome to Round 2!!! Seeds Collected Partner #1Trial #1 Partner #1Trial #2 Partner #2Trial #3 Partner #2Trial #4 Average Repeat the same procedure but this time have another “bird” to compete against! Compete the table and move on to Round 3 where there is “Increased Competition” if you average over 13 seeds. Round 2 - Increased Competition

Unsuccessful in Round 1? Seeds Collected Partner #1Trial #1 Partner #1Trial #2 Partner #2Trial #3 Partner #2Trial #4 Average Did you average over 13 seeds this time? YESNO Go to Round 2, but with another large seed eater as competition on the “large seed” island Get a new “beak” and try yet again (not a possibility in nature) Go to a “large seed” island and start over (even though you have starved to death, you are resurrected)

Successful in Round 2? Welcome to Round 3!! Increased Competition (more than 1 other bird) Seeds Collected Partner #1Trial #1 Partner #1Trial #2 Partner #2Trial #3 Partner #2Trial #4 Average Repeat the same procedure but this time have even more birds to compete against! Don’t fret. It is almost over!

Not successful in Round 2? “Here endeth the lesson…”

So, what did you learn? Birds have evolved many different mechanisms and modifications that make them more well-adapted to the environment in which they live. Structural differences (in beaks) are significant enough to make you into a new species, but you did descend from a common ancestor. The adaptations that are contribute to the most success allow that individual to survive and reproduce. The adaptations that are contribute to a lack of success are not passed on since they either starve or have no “breeding rights”.

Relationships and Biodiversity NYSED Lab Review

What does this lab entail? Seven tests that look at the physical, chemical, and microscopic characteristics of three plants that may be able to create Curol, even though they are not Botana curus (the plants that does produce it). Comparison of data to determine relationships. Define the crucial need for biodiversity.

Test 1 - Structural Characteristics of Plants Species Y Species Z Species X Botana curus QUESTION: Which leaves most closely resemble the leaves produced by Botana curus? Record your observations in the data table.

Test 2 – Structural Characteristics of Seeds Botana curus seeds Species X seeds Species Y seeds Species Z seeds QUESTION: Which seeds most closely resemble the seeds produced by Botana curus? Record your observations in the data table.

Test 3 – Microscopic Internal Structures of Stems QUESTION: Which stem structures most closely resemble the stem structures of Botana curus? Record your observations in the data table. Species Y Species Z Botana curus Species X

Test 4 – Paper Chromatography to Separate Plant Pigments “Spot” your chromatography paper and label it with a pencil. B.curus XYZ Water migrates up paper via capillary action and carries plant pigments with it. B.curus XYZ

Test 5 – Indicator Tests for Enzyme M Botana curus Species X Species Y Species Z Put two drops of each plant Extract in separate wells of the well tray. Indicator Enzyme M Botana curus (“fizzed” a little) Species X (no “fizz”) Species Y (“fizzed” a little) Species Z (“fizzed” a little) Add a small sprinkle of “Indicator Enzyme M” Record your results.

Test 6 – Using Simulated Gel Electrophoresis to Compare DNA Botana curus A T T C C G G A T C G A T C G C C G G A T A T A C T C C G G T A A T A T C Species XA T T G T A C C G G G A T C C G G A C G T C G C G A C T A A T A T A G C A Species YA C C G G T C C G G G A T C G C A C C C G G T A C T C C T G T A A T A T C Species ZA T T C C G G A T C G A T C G C C G G A T A T T C T C C G G T A A T A TC The strips below represent the DNA strands extracted from each plant (B. curus, X, Y, and Z). Each strand will be “cut” between a double C/double G. Therefore, lines are drawn below where each strip should be cut. Then, count up the number of bases and paste appropriately in the simulated Gel Electrophoresis table on the next slide.

Simulated Gel Electrophoresis # of Bases Botana curusSpecies XSpecies YSpecies Z G G A C G T C G C G A C T A A T A T A G C A G G T A C T C C T G T A A T A T C G G A T C G A T C G C CG G G A T C G C A C C CG G A T C G A T C G C C 11 G G A T A T A C T C C 10 9 G G T A A T A T C 8 A T T G T A C C 7 G G G A T C C 6 5 A T T C CG G T C CA T T C C 4 3 A C C

Test 7 – Molecular Evidence for Relationships Botana curusCACGTGGACTGAGGACTC mRNAGUGCACCUGACUCCUGAG Amino acidValHisLeuThrProGlu Species XCACGTGGACAGAGGACACCTC mRNAGUGCACCUGUCUCCUGUGGAG Amino acidValHisLeuSerProValGlu Species YCACGTGGACAGAGGACACCTC mRNAGUGCACCUGUCUCCUGUGGAG Amino acidValHisLeuSerProValGlu Species ZCACGTAGACTGAGGACTTCTC mRNAGUGCACCUGACUCCUGAAGAG Amino acidValHisLeuThrProGlu

And where did you get those Amino Acids from??? AAU

So, what is the closest and most probable alternative source for Curol??? TestMost similar to Botana curus? Test 1 – Structural Characteristics of PlantsSpecies Z as it has the same kind of parallel veination in the leaves. Test 2 - Structural Characteristics of SeedsSpecies Z seeds are flat and striped, much the same as Botana curus seeds are. Test 3 – Microscopic Internal Structure of StemsSpecies Z vascular bundles closely resemble those of Botana curus. Test 4 – Paper Chromatography of PigmentsSpecies Z and Botana curus share a similar pattern of pigmentation in paper chromatography. Test 5 – Indicator Tests for Enzyme MWhile many “fizzed”, once again Species Z and Botana curus reacted the same. Test 6 – Simulated Gel ElectrophoresisIdentical banding pattern in both Botana curus and Species Z. Test 7 – Amino Acid ComparisonSpecies Z and Botana curus have the most similarities.

And the winner is….. Species Z