Pre- and Postmating Reproductive Isolation in Populations of the Red-sided Garter Snake By Rachel McAlister Mentors: Drs. Robert Mason, Suzanne Estes, & Steve Arnold Department of Zoology
Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection (R.A. Fisher 1930).
premating reproductive isolation- behavior preventing individuals from mating and producing offspring. Female gold finches choose mates based on the color and the brightness of their plumage. Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection. Male
post-mating reproductive isolation- prevents a hybrid produced by two different species from developing into a viable, fertile adult. Mule = Donkey X Horse (Sterility) Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection.
Postmating reproductive isolation also occurs as a result of reduced fitness and increased mortality of hybrid offspring. Hybrid Non-hybrid
sexual selection- A difference between the mating success of individuals with a particular phenotype versus individuals with a different phenotype. Galapagos Island Marine Iguana Peacock (Tail length and elaboration) (Body size and aggressiveness) Male-male competition Female choice Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection.
Most research on reproductive isolation is conducted between species, not between populations—the level at which speciation generally occurs.
Research Question Does premating reproductive isolation evolve faster than postmating reproductive isolation in populations of the red-sided garter snake?
Red-sided Garter Snake (Thamnophis sirtalis parietalis) Mate after spring emergence Females can store sperm Highly philopatric-always return to the same den Island-like populations (geographically distinct populations) Populations differ phenotypically Body size Coloration Female pheromone composition Levels of premating isolation Experience sexual selection on body size
* * Snake Island * Inwood * * * Methods: Collected males and females from 2 populations in Manitoba, Canada during May 2003
20 Inwood ♂ 1 Snake Island ♀ 1 Inwood ♀ 20 Snake Island ♂ 1 Snake Island ♀ 1 Inwood ♀ Methods: Premating Reproductive Isolation Simultaneous choice tests
Results: No evidence (yet) for premating isolation Male Population Premating Isolation N=6 Snake Island males MAY prefer their own females over Inwood females. Snake Isl.
Inwood ♀ X Inwood ♂ Snake Isl. ♀ XSnake Isl. ♂ Inwood ♀ XSnake Isl. ♂ Inwood ♂ XSnake Isl. ♀ Methods: Postmating Reproductive Isolation Within- and between-population crosses: { within
Inwood ♀ X Inwood ♂ Snake Isl. ♀ XSnake Isl. ♂ Inwood ♀ XSnake Isl. ♂ Inwood ♂ XSnake Isl. ♀ Methods: Postmating Reproductive Isolation Within- and between-population crosses: { between
Methods: Postmating Reproductive Isolation Body Mass SVL (Snout-Vent Length) & Tail Length Body Condition—regression of SVL on mass Snout Vent/Genitalia
Results: No evidence (yet) for postmating isolation (Hybrids) Cross Standardized Means Inwood♀ x Inwood♂ Inwood♀ x Snake♂ Snake ♀ x Snake♂ Snake♀ x Inwood♂ (Hybrids)
Results: No evidence (yet) for postmating isolation (Hybrids) Cross Standardized Means Inwood♀ x Inwood♂ Inwood♀ x Snake♂ Snake ♀ x Snake♂ Snake♀ x Inwood♂ (Hybrids) Postmating isolation reduction in hybrid fitness correlates compared to within-population offspring
Results: No evidence (yet) for postmating isolation (Hybrids) Cross Standardized Means Inwood♀ x Inwood♂ Inwood♀ x Snake♂ Snake ♀ x Snake♂ Snake♀ x Inwood♂ (Hybrids) Hybrid Vigor?
BUT, because females store sperm, paternity of individual offspring is unknown…
Paternity Assignment Is postmating isolation data confounded by multiple paternity of litters? How many fathers are responsible for a given litter? Sperm precedence: How many offspring sired by experimental male vs. stored sperm?
Methods: Paternity Assignment Determining paternity using two microsatellite markers a) Collect tail tips from known parents & offspring b) Tissue digestion c) DNA extraction d) DNA amplification -Polymerase chain reaction (PCR) e) Genotyping f) Paternity assignment by exclusion GCATACACACACACGAGGTGAC microsatellite
Results: Extensive multiple paternity Multiple paternity was detected in 68% of the litters (15/22) Most litters sired by at least 2 males One litter sired by at least 3 males Number of sires per litter Frequency
Results: Sperm Precedence Experimental males sire 63% of each litter on average. However, for between- population crosses, experimental males sire fewer offspring than experimental males in within-population crosses. (non-significant) Cross Type Fraction of litters sired by experimental male N =11
Conclusions Multiple paternity is common in T. s. parietalis litters 68% of litters were sired by 2 or more males Data on postmating reproductive isolation (i.e., offspring fitness) is likely confounded by multiple paternity. Only about half of each litter was sired by the experimental male; half was sired by stored sperm
Research Question Does premating reproductive isolation evolve faster than postmating reproductive isolation in populations of the red-sided garter snake?
(Hybrids) Reanalyze offspring fitness data taking paternity into account (Hybrids) Future Directions Cross Standardized Means Inwood♀ x Inwood♂ Inwood♀ x Snake♂ Snake ♀ x Snake♂ Snake♀ x Inwood♂
Future Directions Within- and between-population crosses were repeated and offspring await paternity analysis Mating trials will be repeated in May 2005
Acknowledgements Dr. Suzanne Estes Dr. Robert Mason Dr. Steve Arnold HHMI Dr. Kevin Ahern
Premating Isolation Premating isolation = within-population – between-population pairings pairings total number of pairings
Results: Extensive Multiple Paternity Hybrid (between-population) litters have more sires represented than do non- hybrid (within-population) ones NS (non-significant) Cross Type Average # of sires/litter N =11