Single Nucleotide Polymorphism And Association Studies Stat 115 Dec 12, 2006

2 Outline Definition and motivation SNP distribution and characteristics –Allele frequency, LD, population stratification SNP discovery (unknown) and genotyping (known)SNP discovery genotyping SNP association studies –Case control studies, and family based association studiesCase control studies, and family based association studies –Issues related to association studiesIssues related to association studies

3 Mode of inheritance

4 Polymorphism Polymorphism: sites/genes with “common” variation, less common allele frequency >= 1%, otherwise called rare variant and not polymorphic First discovered (early 1980): restriction fragment length polymorphism Some definitions: –Locus: position on chromosome where sequence or gene is located –Allele: alternative form of DNA on a locus

Fundamental rules of genetics Law of Segregation: a diploid parent is equally likely to pass along either of its two alleles P(pass copy 1) = P(pass copy 2) = ½ Law of Random Union gametes unite in a random fashion, so allele A1 is no more likely to unite with allele A1 than A2, for example P(offspring is A1A1) = P(father passes A1) × P(mother passes A1) P(offspring is A1A2) = P(father passes A1) × P(mother passes A2)+ P(mother passes A1) × P(father passes A2) 5 Slides from Karin S. Dorman

Hardy-Weinberg Equilibrium Consider a single locus where there are two alleles segregating in a diploid population. Make the Hardy- Weinberg (HW) assumptions: –No difference in genotype proportions between the sexes. –Synchronous reproduction at discrete points in time (discrete generations) –Infinite population size (so that small variabilities are erased in the average) –No mutation. –No migration –No selection –Random mating 6 Slides from Karin S. Dorman

Deriving HWE Let genotypes at generation t be P 11 (t), P 12 (t), and P 22 (t). Then, Genotype in the next generation will be And p 1 (t+1)=p 1 (t); p 2 (t+1)=p 2 (t) So in one step it returns to the equilibrium! 7 Slides from Karin S. Dorman

A simple example Consider this “population” 8 Slides from Karin S. Dorman

9

10 Slides from Karin S. Dorman

11 SNP Three classes of polymorphic markers: –Biallelic: SNPs and indels, less informative but more frequent & stable –Multiallelic: micro and mini satellites, more dynamic, high copy number loci have high mutation rate –Combination of above two Single Nucleotide Polymorphism –Occasionally short (1-3 bp) indels are considered SNPs too –Come from DNA-replication mistake individual germ line cell, then transmitted

What are Single Nucleotide Polymorphisms (SNPs)? ATGGTAAGCCTGAGCTGACTTAGCGT-AT ATGGTAAACCTGAGTTGACTTAGCGTCAT    SNP SNP indel SNPs result from replication errors and DNA damage They are a ‘polymorphic’ bit state at a nucleoside address

13 Why Should We Care Personalized Medicine –Aithal et al., 1999, Lancet –Warfarin anticoagulant drug –CYP2C9 gene metabolizes warfarin, CYP2C9*1 (wild type) has two allelic variants: CYP2C9*2 & CYP2C9*3 (both single AA change) –Patients with variant alleles are poor warfarin metabolisers, often at higher risk of bleeding Disease gene discovery –Association studies –Chromosome aberrations (copy number changes)

Disease resistant populationDisease susceptible population Resistant people all have an ‘A’ at position 4 in geneX, while susceptible people have a ‘T’ (A/T are the SNPs) Genotype all individuals for thousands of SNPs ATGATTATAG ATGTTTATAGgeneX

SNP Applications in Medicine Gene discovery and allele mapping Association-based (drug) candidate –polymorphism testing of a trait pool Diagnostics / risk profiling Drug response prediction Homogeneity testing / study design Gene function identification

Population Assignment– assessing competing hypotheses The likelihood ratio method Definition of competing hypotheses is essential 16Adapted from a slide of Steve DiFazio

17Adapted from a slide of Steve DiFazio

18

19

Hypothesis testing in statistics … Null hypothesis – assumed true unless there is an overwhelming evidence against it. –P-value – under the null hypothesis assess how “odd” a particular aspect of the data is – the probability of seeing values as extreme or more extreme than the one we saw. –Using the likelihood ratio to find an effective aspect of the data to tell the two hypotheses apart – a way to guide your choice 20

21 SNP Distribution Most common, > 1 SNP / 1KB –Balance between mutation introduction rate and polymorphism lost rate –Most mutations lost within a few generations Often more transitions (A/G, C/T) than transversions (A/T, A/C, G/T, G/C) In non-coding regions, often fewer SNPs at more conserved regions In coding regions, often more synonymous than non-synonymous SNPs

22 SNP Characteristics: Allele Frequency Distribution Most alleles are rare (minor allele frequency < 10%) Allele frequency in different genomes have a large variation –Human > 1 SNP / 600-1KB, –Fly and maize have an order of magnitude greater number of polymorphism (1 SNP / bp) Nucleotide diversity is positively correlated with recombination rate

International HapMap Project The International HapMap project is a recent, large-scale effort to facilitate GWAS studies: –Phase 1: 269 samples, 1.1 M SNPs –Phase 2: 270 samples, 3.9 M SNPs –Phase 3: 1115 samples, 1.6 M SNPs Phase 3 platforms: –Illumina Human1M (by Wellcome Trust Sanger Institute) –Affymetrix SNP 6.0 (by Broad Institute) 23