Challenging Traditional Approaches to Computation

Slides:

Advertisements

Similar presentations

POSTER TEMPLATE BY: tions.com r 2 p 1 Challenging Traditional Approaches to Computation: A Biomolecular Transducer Employing Ternary.

Advertisements

Existing “autonomous” system Sakamoto & Hagiya State transitions by molecules A transition table:{S  S’} Starting from the initial state, calculate as.

Online Counseling Resource YCMOU ELearning Drive…

Keywords: Gene, chromosomes, undifferentiated plasmid, base pairs, Keywords: hydrogen bonds, B2 Topic 1 The Components of Life This topic looks at: DNA.

Molecular Computing Machine Uses its Input as Fuel Kobi Benenson Joint work with Rivka Adar, Tamar Paz-Elizur, Zvi Livneh and Ehud Shapiro Department of.

V) BIOTECHNOLOGY.

Chapter 4: recombinant DNA

11 Biobrick Jiale Wang SUSTC. 2 Definition What is Biobrick ? BioBrick standard biological parts are DNA sequences of defined structure and function;

1 DNA Computing: Concept and Design Ruoya Wang April 21, 2008 MATH 8803 Final presentation.

Abstract: This research concentrates on constructing a two-symbol-two- state finite automaton made entirely of molecular components. The output contains.

What makes DNA Computing possible? Great advances in molecular biology –PCR (Polymerase Chain Reaction) –DNA Selection by affinity –DNA Filtering –DNA.

Mutagenesis Methods Lily Peterson April 5 th, 2010.

DNA Computing DCS 860A-2008 Team 3 December 20, 2008 Marco Hernandez, Jeff Hutchinson, Nelson Kondulah, Kevin Lohrasbi, Frank Tsen.

General Microbiology (Micr300) Lecture 11 Biotechnology (Text Chapters: ; )

Restriction Enzymes.

Genomic DNA & cDNA Libraries

 Restriction Enzymes are part of the essential tools of genetic engineering. They have the ability to cut DNA molecules at very precise sequences of.

Simulation of Biochemical Reactions for Modeling of Cell DNA Repair Systems Dr. Moustafa Mohamed Salama Laboratory of Radiation Biology, JINR Supervisor.

TOOLS OF GENETIC ENGINEERING

Section 20.3 – DNA and Biotechnology. DNA and Biotechnology  Carpenters require tools such as hammers, screwdrivers, and saws, and surgeons require scalpels,

PRINCIPLES OF BIOTECHNOLOGY

Objective 2: TSWBAT describe the basic process of genetic engineering and the applications of it.

Programming Bacteria for Optimization of Genetic Circuits.

From Haystacks to Needles AP Biology Fall Isolating Genes  Gene library: a collection of bacteria that house different cloned DNA fragments, one.

Lab 5: Cellular Respiration

© 2006 W.W. Norton & Company, Inc. DISCOVER BIOLOGY 3/e 1 Manipulation of DNA Selective breeding has manipulated DNA f/ eons  Domesticated animals demonstrate.

Restriction enzymes (endonucleases)

-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.

Recombinant DNA and Biotechnology Gene cloning in bacterial plasmids Plasmid – extrachromosomal piece of DNA not necessary for survival can be transferred.

Enzymes Used for Gene Engineering 1. Restriction endonuclease (restriction enzymes) 2. DNA modifying enzymes a polymerases b nucleases c enzymes that modify.

Biotechnology DNA technology. Review Some of the most important techniques used in biotechnology involve making recombinant DNA molecules Recombinant.

Manipulating DNA.

DNA Computing BY DIVYA TADESERA. Contents  Introduction  History and its origin  Relevancy of DNA computing in 1. Hamilton path problem(NP problem)

Biotechnology Biology- Regular John Murnan Etowah High School.

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Gene Technology. At the beginning: Studies using interferon: – Interferon increases human resistance to viral infection and scientists were interested.

Stochastic Computing with Biomolecular Automata Advanced Artificial Intelligence Cho, Sung Bum.

Used for detection of genetic diseases, forensics, paternity, evolutionary links Based on the characteristics of mammalian DNA Eukaryotic genome 1000x.

Biotechnology What does it mean? Tools and Technologies Selected Applications Biotechnology 1: any method based on knowledge of biological processes that.

Introduction to Biotechnology ~manipulating and analyzing DNA.

Developing an Algorithm. Simple Program Design, Fourth Edition Chapter 3 2 Objectives In this chapter you will be able to: Introduce methods of analyzing.

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Branching in Biological Models of Computation Blair Andres-Beck, Vera Bereg, Stephanie Lee, Mike Lindmark, Wojciech Makowiecki Mike Lindmark, Wojciech.

VLSI AND INTELLIGENT SYTEMS LABORATORY 12 Bit Hamming Code Error Detector/Corrector December 2nd, 2003 Department of Electrical and Computer Engineering.

DNA Splicing Systems By William DeLorbe and Dr. Elizabeth Goode.

Playing cards for Memory and Total recall Pages 2 to 4: keyword-cards Pages 5 to 7: keyword-cards with corresponding explanation-cards.

Unit 2 The Molecule of Life Genes and Heredity. What is a gene?

Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology.

LECTURE 3 Gene Transcription and RNA Modification (Chapter 12)

Steps to Recombinant DNA 1) Isolate the foreign DNA fragment 2) Attach DNA fragment to a “vehicle” called a Vector 3) Transfer the vector into a host.

710.LC GRADUATE MOLECULAR BIOLOGY 10/31/2011. Lecture 4 Competency Test.

Chapter 10 Student DNA REPLICATION “It has not escaped our notice that the specific pairing we have postulated immediately suggested a possible.

 Biotechnology includes genetic engineering and other techniques that make use of natural biological systems to produce a product or to achieve an end.

Electrophoresis is a molecular technique that separates nucleic acids and proteins based on Size and +-+ Charge +-+

Genetic Changes  Humans have changed the genetics of other species for thousands of years by selective breeding  Causing Artificial Selection  Natural.

DNA Technology. Definitions Genetic engineering - process of altering genes to combining DNA from two or more organisms. Genetic engineering - process.

DNA Technologies (Introduction)

Introduction to Biotechnology

21.8 Recombinant DNA DNA can be used in

PCR Polymerase Chain Reaction

Cloning Overview DNA can be cloned into bacterial plasmids for research or commercial applications. The recombinant plasmids can be used as a source of.

Chapter 14 Bioinformatics—the study of a genome

Chapter 9 Molecular Genetic Techniques and Genomics

The transcription process is similar to replication.

Peng Yin… Presented by Sung-kyu Kim

Tamar Ratner, Ron Piran, Natasha Jonoska, Ehud Keinan

Processes of DNA 10th Grade Biology.

Genetic Egineering Isolation Cutting Ligation and Insertion

Presentation transcript:

Challenging Traditional Approaches to Computation Challenging Traditional Approaches to Computation A Biomolecular Transducer Employing Ternary Language and Rendering a Biological Output Mark Chaskes and Paul Lazarescu Mentor: Tamar Ratner The Schulich Faculty of Chemistry Technion, Haifa, Israel, 32000

Objective Design a theoretical biomolecular transducer to solve consecutive mathematical equations in ternary. -First divide an input by three and then divide the yeild of that by two

What is biomolecular computing? A biomolecular computer is a group of molecules that ‘read’ dsDNA and can ‘print’ an output.

What is a DNA based transducer? A transducer is not a PC; it has unique capabilities that an ordinary computer does not. Advantages include: Direct interface with a biological system Can release a biological output Able to compute in parallel Store large amounts of data in a small volume

Schematic Diagram S0 S1 Key S0 and S1 are states “a” and “b” are symbols Begins in S0 and changes states depending on read symbols

Design on the Molecular Level Symbols are dsDNA strands Restriction enzymes cleave the sequence at recognition sites States are determined by the location of cleavage within the symbol

Reading 2 from S0 prints 0 and goes to S2 Process Divide by three transducer reading the input 2-0-0 Reading 2 from S0 prints 0 and goes to S2 State 0 2

Reading 0 from S2 prints 2 and goes to S0 Process Divide by three transducer reading the input 2-0-0 Reading 0 from S2 prints 2 and goes to S0 State 2

Reading 0 from S0 prints 0 and encodes the output 0-2-0 Process Divide by three transducer reading the input 2-0-0 Reading 0 from S0 prints 0 and encodes the output 0-2-0 2 State 0

Reading 0 from S0 prints 0 and goes to S0 Process Divide by two transducer reading the input 0-2-0 S1 Reading 0 from S0 prints 0 and goes to S0 State 0 2

Reading 2 from S0 prints 1 and goes to S0 Process Divide by two transducer reading the input 0-2-0 S1 Reading 2 from S0 prints 1 and goes to S0 State 0 2

Reading 0 from S0 prints 0 and goes to S0 Process Divide by two transducer reading the input 0-2-0 S1 Reading 0 from S0 prints 0 and goes to S0 1 State 0

Molecular Design of the Input Encoding 2-0-0 in Ternary (18 in base ten) Terminator EagI Recognition Site BbvI Recognition Site Spacers 2 0 0 AATTCGGCCGTT..8 base..CTCCTCGCAGC..8 base..CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAA..pairs ..GAGGAGCGTCG..pairs ..GAGCAATCAGAATCAGAAACGACTTTAA Plasmid BseRI Recognition Site

Divide-by-three Computation First Restriction AATTCGGCCGTT..8 base..CTCCTCGCAGC..8 base..CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAA..pairs ..GAGGAGCGTCG..pairs ..GAGCAATCAGAATCAGAAACGACTTTAA GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CAGA S1 to S0, read 0, print 1 CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...AGAA S2 to S0, read 0, print 2 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...TCAG S0 to S0, read 0, print 0 AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...CCAT S0 to S1, read 1, print 0 GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CATA S1 to S1, read 1, print 1 CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...ATAA S2 to S1, read 1, print 2 GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...AGCA S1 to S2, read 2, print 1 AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC S0 to S2, read 2, print 0 CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...GCAA S2 to S2, read 2, print 2

Divide-by-three Computation First Restriction AATTCGGCCGTT CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGC AATCAGAATCAGAAACGACTTTAA GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CAGA S1 to S0, read 0, print 1 CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...AGAA S2 to S0, read 0, print 2 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...TCAG S0 to S0, read 0, print 0 AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...CCAT S0 to S1, read 1, print 0 GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CATA S1 to S1, read 1, print 1 CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...ATAA S2 to S1, read 1, print 2 GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...AGCA S1 to S2, read 2, print 1 AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC S0 to S2, read 2, print 0 CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...GCAA S2 to S2, read 2, print 2

Divide-by-three Computation First Ligation AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC Transition Molecule S0 to S2, reading 2, printing 0 AATTCGGCCGTT CTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGC AATCAGAATCAGAAACGACTTTAA DNA Ligase CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...AGAA S2 to S0, read 0, print 2 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...TCAG S0 to S0, read 0, print 0 GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CAGA S1 to S0, read 0, print 1 AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...CCAT S0 to S1, read 1, print 0 GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CATA S1 to S1, read 1, print 1 CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...ATAA S2 to S1, read 1, print 2 GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...AGCA S1 to S2, read 2, print 1 S0 to S2, read 2, print 0 CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...GCAA S2 to S2, read 2, print 2 AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC

Divide-by-three Computation First Ligation AATTCGGCCGTTAGTCTT...8 base...CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA...pairs ...GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA AATTCGGCCGTTAGTCTT...8 base...CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA...pairs ...GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA CTCGTT...8 base...CTCCTCGCAGC...4 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...AGAA S2 to S0, read 0, print 2 AGTCTT...8 base...CTCCTCGCAGC...2 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...TCAG S0 to S0, read 0, print 0 GGTATT...8 base...CTCCTCGCAGC...3 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CAGA S1 to S0, read 0, print 1 AGTCTT...8 base...CTCCTCGCAGC...1 base AATCAGAA...pairs ...GAGGAGCGTCG...pairs...CCAT S0 to S1, read 1, print 0 GGTATT...8 base...CTCCTCGCAGC...2 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...CATA S1 to S1, read 1, print 1 CTCGTT...8 base...CTCCTCGCAGC...3 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...ATAA S2 to S1, read 1, print 2 GGTATT...8 base...CTCCTCGCAGC...1 base AACCATAA...pairs ...GAGGAGCGTCG...pairs...AGCA S1 to S2, read 2, print 1 S0 to S2, read 2, print 0 CTCGTT...8 base...CTCCTCGCAGC...2 base AAGAGCAA...pairs ...GAGGAGCGTCG...pairs...GCAA S2 to S2, read 2, print 2 AGTCTT...8 base...CTCCTCGCAGC AATCAGAA...pairs ...GAGGAGCGTCGGAGC

Continue cycle of restriction, hybridization, and ligation until terminator is cleaved AATTCGGCCGTTAGTCTT...8 base...CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA...pairs ...GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA AATTCGGCCGTTAGTCTT...8 base...CTCCTCGCAGCCTCGTTAGTCTTAGTCTTTGCTGAAATT TTAAGCCGGCAATCAGAA...pairs ...GAGGAGCGTCGGAGCAATCAGAATCAGAAACGACTTTAA

Divide-by-three Computation Final Restriction AATTCGGCCGTTAGTCTTCTCGTTAGTCTT TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAG CTTTAA

Divide-by-three Computation Final Ligation TGCTGA...Reporter... AAACGACT....Gene 0....ACGA Detection Molecule AATTCGGCCGTTAGTCTTCTCGTTAGTCTT TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAG CTTTAA

Divide-by-three Computation Final Ligation AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA 0 2 0 This transducer has printed 020, which is 6 in base ten (610). Check: 18/3 = 6? Yes.

Biological Function 0 AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA Biological Function 0 could be releasing a drug, changing the bacteria phenotype, etc.

Divide-by-two Computation Transition Stage AATTCGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA A third restriction enzyme that cleaves within its recognition site is necessary only when consecutive computation (using two separate transducers) occurs.

Divide-by-two Computation Transition Stage GGCCTTTCTCCTCGCAGCT AAAGAGGAGCGTCGACCGG Reinsertion Molecule AATTC GGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGG CAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA Reinsertion of the recognition sites is also required for consecutive computation.

Divide-by-two Computation Transition Stage AATTCGGCCTTTCTCCTCGCAGCTGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGAAAGAGGAGCGTCGACCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA

Divide-by-two Computation Entire cycle repeats again until terminator is cleaved once more AATTCGGCCTTTCTCCTCGCAGCTGGCCGTTAGTCTTCTCGTTAGTCTTTGCTGA...Reporter...TGCTGAAATT TTAAGCCGGAAAGAGGAGCGTCGACCGGCAATCAGAAGAGCAATCAGAAACGACT....Gene 0....ACGACTTTAA

Divide-by-two Computation Final Restriction AATTAGTCTTGGTATTAGTCTT TGCTGA...Reporter...TGCTGAAATT TTAATCAGAACCATAATCAG CT....Gene 0....ACGACTTTAA

Divide-by-two Computation Final Ligation TGCTGA...Reporter... AAACGACT....Gene 0....ACGA Detection Molecule AATTAGTCTTGGTATTAGTCTT TGCTGA...Reporter...TGCTGAAATT TTAATCAGAACCATAATCAG CT....Gene 0....ACGACTTTAA

Divide-by-two Computation Final Ligation AATTAGTCTTGGTATTAGTCTTTGCTGA...Reporter...TGCTGA...Reporter...TGCTGAAATT TTAATCAGAACCATAATCAGAAACGACT....Gene 0....ACGACT....Gene 0....ACGACTTTAA 0 1 0 (310) This transducer has printed 010, which is 3 in base ten. Check: (18/3)/2 = 3? Yes.

Biological Function 0 AATTAGTCTTGGTATTAGTCTTTGCTGA...Reporter...TGCTGA...Reporter...TGCTGAAATT TTAATCAGAACCATAATCAGAAACGACT....Gene 0....ACGACT....Gene 0....ACGACTTTAA

Discussion & Conclusions This project worked as expected. 18 ÷ 3= 6 ; 6 ÷ 2= 3 No molecule encoded the recognition site of an enzyme Proof of concept worked however not done in practicality. Transducers engineered functioned as coded

Acknowledgements We would like to sincerely thank Mr. Russell N. Stern for his generosity and donation. Thank you to the Louis Herman Israel Experience Fund for their contribution. We would also like to thank our mentor Tamar Ratner, for her continued dedication and help. Finally, we would like to thank Professor Ehud Keinan for allowing us to use his laboratory and his student.