Section J – Analysis and uses of cloned DNA

Plant cell Animal cell

Contents J1 Characterization of clones J2 Nucleic acid sequencing Characterization, Restriction mapping, Partial digestion, Labeling nucleic acid, Southern and Northern blotting J2 Nucleic acid sequencing DNA sequencing, RNA sequencing, Sequence databases, Analysis of sequences, Genome sequencing projects J3 Polymerase of cloned genes PCR, the PCR cycle, Template, Primers, Enzymes, PCR optimization, PCR variations J4 Organization of cloned genes Organization, Mapping cDNA on genomic DNA, S1 nuclease mapping, Primer extension, Gel retardation, DNaseⅠ footprinting, Reporter genes J5 Mutagenesis of cloned genes Deletion mutagenesis, Site-directed mutagenesis, PCR mutagenesis J6 Applications of cloned genes Applications, Recombinant protein, Genetically modified organisms, DNA fingerprinting, Medical diagnosis, Gene therapy

J1 Characterization of clones — Characterization Preparation of pure DNA is the first step of any characterization. Plasmid DNA: from bacterial colonies Bacteiophage DNA: Plaque purified phage → → infecting a bacterial culture → → cell lysis → → phage particles → → phenol-chloroform, ethanol precipitate → → Bacteiophage DNA

J1 Characterization of clones — Restriction mapping Example1： Digests Resultant Fragments EcoRI 3 kb, 5 kb HindIII 2 kb, 6 kb EcoRI + HindIII 2 kb, 1 kb, 5 kb The most common application of restriction mapping is presented: Determining the orientation of a cloned insert. This method requires that restriction maps of the cloning vector and the insert are already available.

J1 Characterization of clones — Restriction mapping Example2：

J1 Characterization of clones — Partial digestion 3kb 1kb 2kb 4kb 10 kb insert Complete digestion Partial digestion 10 kb 7 kb 6 kb 4 kb Can not delineate the restriction sites. 3 kb 2 kb 1 kb

* * * * 6 kb 4 kb 3 kb 10 kb End-labeled radioactive DNA 6 kb 4 kb Delineate the restriction sites by partial digested end-labeled radioactive DNA. E E E * 3kb 1kb 2kb 4kb 10 kb insert * 6 kb * 4 kb * 3 kb 10 kb End-labeled radioactive DNA 6 kb 4 kb Partial digestion 3 kb Agarose electrophoresis Autoradiography

J1 Characterization of clones — Labeling nucleic acid Radioactive labeling: display and/or magnify the signals by radioactivity Non-radioactive labeling: display and/or magnify the signals by Biotin and digoxin etc 1.End labeling: put the labels at the ends 2.Uniform labeling: put the labels internally

End labeling （1）Single stranded DNA/RNA 5’-end labeling: dephosphorylation  polynucleotide kinase 3’-end labeling: terminal transferase

（2）Double stranded DNA/RNA Fill in the recessive 3’-ends（ 3’-凹端） by DNA polymerase. Labeled at both ends 5’pAATTC G ---------------------G ---------------------CTTAAp5’ For restriction mapping, cut the DNA with another enzyme

2. Uniformly labeling of DNA/RNA （1）Nick translation （切口平移）: DNase I to introduce random nicks DNA Pol I to remove dNTPs from 5’ to 3’ and add new dNTP including labeled nucleotide at the 3’ ends.

（2）Hexanucleotide primed labeling(六聚核苷酸引物标记，random labeling 随机标记）: Denature DNA  add random hexanucleotide primers and DNA pol  synthesis of new strand incorporating labeled nucleotide.

3. Specific probes （1）Strand-specific DNA probes: e.g.M13 DNA as template the missing strand can be re- synthesized by incorporating radioactive nucleotides.

（2）Strand-specific RNA probes

J1 Characterization of clones — Southern and Northern blotting Southern blotting, for detecting DNA ; Northern blotting, for detecting RNA; Western blotting, for detecting protein. Blot type Target Probe Applications Southern DNA DNA or RNA mapping genomic clones estimating gene numbers Northern RNA RNA sizes, abundance, and expression Western Protein Antibodies protein size, abundance

1.Genomic DNA preparation 2.Restriction digestion 3.Denature with alkali 4.Agarose gel electrophoresis 5.DNA blotting/ transfer and fixation 6.Probe labeling 7.Hybridization (temperature) 8.Signal detection (X-ray film or antibody)

Southern analysis

Northern blotting

J2 Nucleic acid sequencing — DNA sequencing Three main methods: 1. Maxam and Gilbert chemical method  2. Sanger`s enzymatic method  3. Sequencing by hybridization (SBH)

1. Maxam and Gilbert chemical method The end-labeled DNA is subjected to base-specific cleavage reactions prior to gel separation. Modification of bases: Methylation by dimethyl sulfate ：G (DMS) Formic acid: Purines A & G Hydrazine : hydrolyze T & C Hydrazine + high salt: only C

* G A+G C+T C A A A G A T T A A G C C Dimethyl sulfate Formic acid Hydrazine Hydrazine+high salt G A+G C+T C 烷基转移酶

2. Sanger`s enzymatic method Uses dideoxynucleotides as chain terminators to produce a ladder of molecules generated by polymerase extension of primer

A C G T Sanger’s method Template +primer (15-17nt) +dNTPs +ddNTPs +[35S]dATP +T7 DNA pol PAGE Autoradiography 3’GTGACTACTCAGGCACTTGCTTTGCC5’

Automatic sequencer

3. Sequencing by hybridization (SBH)

J2 Nucleic acid sequencing — RNA sequencing By base-specific cleavage of 5’-end-labeled RNA using RNases that cleave 3’ to a particular nucleotide. Partial digestion is required to generate a ladder of cleavage products which are analyzed by PAGE.

RNase T1: cleaves after G RNase U2: after A RNase Phy M: after A and U Bacillus cereus RNase: after U and C

J2 Nucleic acid sequencing — Sequence databases DDBJ(日本国家遗传学研究所) http://www.ddbj.nig.ac.jp EMBL-EBI (欧洲生物信息研究所) : http://www.ebi.ac.uk/Databases/index.html Genbank at NCBI （美国国家生物技术信息中心）: http://www.ncbi.nlm.nih.gov

J2 Nucleic acid sequencing — Analysis of sequences Using computers and software packages, such as GCG sequence analysis package. 1. Identify important sequence features such as restriction sites, open reading frames, start and stop codons, as well as potential promoter sites, intron-exon junctions, etc.

ORF #2 ORF #1 100 200 300 400 500 600 700 Sequence analysis of a cloned DNA sequence revealed some important features

2. Homology search by BLAST (NCBI) or FASTA (EBI): Compare new sequence with all other known sequences in the databases, which can determine whether related sequences have been obtained before.

J2 Nucleic acid sequencing — Genome sequencing projects With the development of automated DNA sequencers and robotic workstations to prepare samples for sequencing, the entire genome sequence of several organisms have been determined. Many phages and viruses Several Bacteria (E. coli, 4 x 106) Plant (Arabidopsis 6.4 x 107 , rice) Human 3.3 x 109

J3 Polymerase of cloned genes — PCR The polymerase chain reaction (PCR)： To amplify a sequence of DNA using a pair of primers each complementary to one end of the DNA target sequence.

J3 Polymerase of cloned genes — the PCR cycle Denaturation : The target DNA (template) is separated into two stands by heating to 95℃ Primer annealing : The temperature is reduced to around 55℃ to allow the primers to anneal. Polymerization (elongation, extension): The temperature is increased to 72℃ for optimal polymerization step which uses up dNTPs and required Mg++.

J3 Polymerase of cloned genes — Template Single-or double-stranded form; The size of the template DNA is not critical; In the case of mammalian or plant genomic DNA, up to 1.0 ug of DNA is utilized per reaction. The typical amounts of yeast, bacterial, and plasmid DNAs used per reaction are 10 ng, 1ng, and 1pg, respectively; Template DNA is dissoved in 10 mM Tris-Cl (pH 7.6) containing a low concentration of EDTA (<0.1 mM).

J3 Polymerase of cloned genes — Primers PCR primers：about 18 to 30 nt long and with similar G+C contents. Tm=2(a+t)+4(g+c): determine annealing temperature. If the primer is 18-30 nt, annealing temperature can be Tm-5oC.

An oligo pool derived from protein sequence. If the target DNA is not known,there is only limited amino acid sequence available. Degenerate primers An oligo pool derived from protein sequence. E.g. His-Phe-Pro-Phe-Met-Lys can generate a primer CAU(CAC)-UUU(UUC)-CCU(CCC,CCA,CCG)- UUU(UUC)-AUG-AAA(AAG) 2x2x4x2x2 =64

J3 Polymerase of cloned genes — Enzymes The most common is Taq polymerase from Thermus aquaticus. It has no 3’ to 5’ proofreading exonuclease activity. Accuracy is low, not good for cloning. Pfu (Pyrococcus furiosus, Promega & Stratagene),

J3 Polymerase of cloned genes — PCR optimization PCR cycle Enzymes Template DNA Mg++

J3 Polymerase of cloned genes — PCR variations 1. Inverse PCR, IPCR 2. Anchored PCR, APCR 3. asym metric PCR 4. Reverse transcription RT-PCR 5. 修饰引物PCR 6. Nest PCR 7. multiplex PCR 8. 重组PCR 9. differential PCR, d-PCR 10. quantitative PCR, qPCR 11. in situ PCR 12. immuno-PCR 13. Thermal Asymmetric Interlaced PCR，TAIL-PCR

J4 Organization of cloned genes — Organization The absent sequences are usually introns and sequences upstream of the transcription start site and down stream of the 3’-processing site. Start and stop sites for transcription regulatory sequences.

J4 Organization of cloned genes — Mapping cDNA on genomic DNA The genomic clone is digested on a gel and then subjected to Southern blot using all or part of the cDNA as a probe. Show which genomic restriction fragments contain cDNA sequences 　Using a probe from one end of a cDNA can show the polarity of the gene in the genomic clone. Some of the restriction sites will be common in both clones but may be different distances apart.

J4 Organization of cloned genes — S1 nuclease mapping Determines the precise 5’- and 3’- ends of RNA transcripts. Sequence ladder is required to determine the precise position.

J4 Organization of cloned genes — Primer extension A primer is extended by a polymerase until the end of the template is reached and the polymerase dissociated. The length of the extended product indicates the 5’end of temple.

J4 Organization of cloned genes — Gel retardation Mixing a protein extract with a labeled DNA fragment and running the mixture on a native gel will show the presence of DNA-protein complex as retarded bands on the gel.

J4 Organization of cloned genes — DNaseⅠ footprinting The ‘footprint’ of a protein bound specifically to a DNA sequence can be visualized by treating the mixture of end-labeled DNA plus protein with small amounts of DNase I prior to running the mixture on a gel. The footprint is a region with few bands in a ladder of cleavage products.

J4 Organization of cloned genes — Reporter genes To study the function of a control element of a gene like HSP70 (promoter and regulatory elements). Reporter genes such as β -galactosidase or luciferase to “report” the promoter action.

J5 Mutagenesis of cloned genes — Deletion mutagenesis In the cDNA clones,it is common to delete progressively from the ends of the coding region to discover which parts of the whole protein have particular properties.

Exunuclease III： Unidirectional deletion using exonuclease III.

J5 Mutagenesis of cloned genes — Site-directed mutagenesis Formerly, single-stranded templates prepared using M13 were used：Primer oligonucleotide with desired mutation, extension by DNA polymerase, then ligation. Now PCR techniques are now preferred

J5 Mutagenesis of cloned genes — PCR mutagenesis By making forward and reverse mutagenic primers and using other primers that anneal to common vector sequence, two PCR reactions are carried out to amplify 5’- and 3’- portions of the DNA to be mutated. The tow PCR products are mixed and used for another PCR using the outer primers only-Part of this product is then subcloned to replace the region to be mutated in the starting molecule.

J6 Applications of cloned genes — Applications Recombinant protein production Genetically modified organisms DNA fingerprinting Diagnostic kits Gene therapy

J6 Applications of cloned genes — Recombinant protein Recombinant proteins ：Growth hormone, insulin for diabetes，interferon in some immune disorders，blood clotting factor VIII in for hemophilia.

J6 Applications of cloned genes — Genetically modified organisms Introducing a foreign gene into an organism which can propagate creates a genetically modified organism. Transgenic sheep have been crested ro produce foreign proteins in their milk. Cloned genes are introduced into germ cells.

J6 Applications of cloned genes — DNA fingerprinting Hybridizing southern blots of genomic DNA with probes that recognize simple nucleotide repeats gives a pattern that is unique to an individual and can be used an a fingerprint. This has applications in forensic science, animal and plant breeding and evolutionary studies. Simple nucleotide repeats vary in number between individuals but are inherited.

J6 Applications of cloned genes — Medical diagnosis The sequence information derived from cloning medically important genes has allowed the design of many diagnostic test kit which can help predict and confirm a wide range of disorders. By using sequence information to screen patients.

J6 Applications of cloned genes — Gene therapy Attempts to correct a genetic disorder by delivering a gene to a patient are described as gene therapy. To treat some genetic disorders by delivering a normal copy of the defective gene to patients. The gene can be cloned into a virus that can replicate but not cause infection.

Multiple choice questions 1. A linear DNA fragment is (100%) labeled at one end and has 3 restriction sites for EcoRI. If it is partially digested by EcoRI so that all possible fragments are produced how many of these fragments will be labeled and how many will not be labeled? A 4 labeled; 6 unlabeled. B 4 labeled; 4 unlabeled. C 3 labeled: 5 unlabeled. D 3 labeled; 3 unlabeled. 2. Which of the following are valid methods of labeling duplex DNA? A 5'-end labeling with polynucleotide kinase. B 3'-end labeling with polynucleotide kinase. C 3'-end labeling with terminal transferase. D 5'-end labeling with terminal transferase. E nick translation.

3. Which one of the following statements about nucleic acid sequencing is correct? A. the Sanger method of DNA sequencing involves base specific cleavages using piperidine. B. the Maxam and Gilbert method of DNA sequencing uses a DNA polymerase and chain terminat­ing dideoxynucleotides. C. enzymatic sequencing of RNA uses RNases A, T1, Phy M and B. cereus RNase. D enzymatic sequencing of DNA uses a primer which is extended by an RNA polymerase. E enzymatic sequencing of RNA uses RNases T1, U2, Phy M and B. cereus RNase. 4 Which one of the following statements about peR is false? A the PCR cycle involves denaturation of the template，annealing of the primers and polymerization of nucleotides. B PCR uses thermostable DNA polymerases. C ideally PCR primers should be of similar length and G+C content. D PCR optimization usually includes varying the magnesium concentration and the polymerization temperature. E if PCR was 100% efficient, one target molecule would amplify to 2n after n cycles.

5. Which two of the following statements about gene mapping techniques are true? A. S1 nuclease mapping determines the nontranscribed regions of a gene. B. primer extension determines the 3'-end of a transcript. C. gel retardation can show whether proteins can bind to and retard the migration of a DNA frag­ment through an agarose gel. D. DNase I footprinting determines where on a DNA fragment a protein binds. E the function of DNA sequences in the promoter of a gene can be determined if they are ligated downstream of a reporter gene and then assayed for expression. 6. Which one of these statements about mutagenesis techniques is false? A. exonuclease III removes one strand of DNA in a 5' to 3' direction from a recessed 5'-end. B. exonuclease III removes one strand of DNA in a 3' to 5' direction from a recessed 3'-end. C. mutagenic primers can be used in PCR to introduce base changes. D. mutagenic primers can be used with a single stranded template and DNA polymerase to intro­duce base changes. E. deletion mutants can be created using restriction enzymes.

7. Which one of these statements about the applications of gene cloning is false? A large amounts of recombinant protein can be produced by gene cloning. B DNA fingerprinting is used to detect proteins bound to DNA. C cloned genes can be used to detect carriers of disease-causing genes. D gene therapy attempts to correct a disorder by delivering a good copy of a gene to a patient. E genetically modified organisms have been used to produce clinically important proteins.

THANK YOU !