Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes

Genetic anomalies 1. Chromosome abnormalities or rearrangements 2. Gene defects: mutations

Level of resolution Molecular level Cytogenetic level ATGCACTGATGAATGCATGCAAT A gene: about 20 kb From 1 b to 1000 b Molecular level Cytogenetic level Chromosomal band: 5-10 Mb Genome: 3x109 bases

Chromosome abnormalities Different types Balanced anomalies: associated with a normal phenotype for the majority 11 22

Chromosome abnormalities Different types Balanced anomalies: associated with a normal phenotype for the majority Unbalanced anomalies: with a gain or a loss of genetic material usually with abnormal phenotype

Chromosome abnormalities At birth 0.6 à 0.9% of the newborns carry a chromosomal anomaly  high pressure of selection during fetal development Third trimester miscarriages: 5% of the fetuses carry a chromosomal anomaly First trimester miscarriages: 60% of the fetuses carry a chromosomal anomaly

Chromosome abnormalities Constitutional / Acquired Homogeneous / Mosaic

Meiosis Fecundation Mitosis Birth

Chromosome abnormalities Constitutional / Acquired Homogeneous / Mosaic Numerical / structural Balanced Unbalanced

Numerical abnormalities

Numerical abnormalities : the ploidy Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes

Numerical abnormalities : the ploidy Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes Polyploidy : more than 2 haploïd sets of chromosomes (ex: triploidy)

Numerical abnormalities : polyploidy Anomaly at fecundation Triploidy : 69,XXX or 69,XXY or 69,XYY Tetraploidy : 92,XXYY or 92,XXXX (hemopathies, tumors)

Numerical abnormalities : example of a triploid cell 69,XXX

Numerical abnormalities : Diploidy (normal somatic cell) : 2 haploïd chromosome sets Polyploidy : more than 2 haploïd chromosome sets (ex: triploidy) Aneuploidy : Gain of one (or more) chromosome (trisomy) Loss of one (or more) chromosome (monosomy)

Numerical abnormalities : example of trisomy 21 (autosome)

Numerical abnormalities : example of monosomy X

Mechanisms of the aneuploidies Non-disjunction in meiosis First division in meiosis I Second division in meiosis II Post-zygotic mitotic non-disjunction

Mechanisms of the aneuploidies: meiosis I non disjunction MI MII Most often: homogeneous anomaly

Mechanisms of the aneuploidies: meiosis II non disjunction Most often: homogeneous anomaly MI MII

Mechanisms of the aneuploidies Non-disjunction in meiosis First division in meiosis I Second division in meiosis II Post-zygotic non-disjunction in mitosis

Mechanisms of the aneuploidies: post-zygotic non-disjunction in mitosis Zygote (post Fecundation) Most often: mosaics

Aneuploidies mat MI MII pat Trisomy 21 91% 75% Trisomy 18 93% 60% 45,X 80% 47,XXY 53% 47%

STRUCTURAL ANOMALIES

Structural anomalies Balanced ---> Normal phenotype but risk to future offspring Unbalanced Deletion Duplication Derived chromosome ---> usually associated with abnormal phenotype

Structural anomalies Only one chromosome involved One breakage: terminal deletion Two breakages: one arm: interstitial deletion paracentric inversion two arms: pericentric inversion ring chromosome isochromosome Two chromosomes involved Robertsonian translocation Reciprocal translocation

Structural anomalies Only one chromosome involved One breakage: terminal deletion

Terminal deletions (del) One breakage: terminal deletion loss neotelomere breakage del(4)(p15.3)

Terminal deletions (del) 4p deletion 5p deletion : Cri du chat syndrome

Structural anomalies Only one chromosome involved One breakage: terminal deletion Two breakages: one arm: interstitial deletion

Interstitial deletions Two breakpoints on the same chromosome arm and loss of the chromosome region between: interstitial deletion loss of the chromosome region between Two breakpoints

Anomalies de structure Only one chromosome involved One breakage: terminal deletion Two breakages: one arm: interstitial deletion paracentric inversion two arms: pericentric inversion ring chromosome isochromosome Two chromosome involved Robertsonian translocation: centric fusion

Robertsonian translocations Involve two acrocentric chromosomes Breakpoints located at the centromere or close to Loss of the short arms Loss of a centromere Karyotype with 45 chromosomes Consequences in meiosis

Robertsonian translocations (rob ou der) fusion loss rob(13;14)(q10;q10) ou der(13;14)(q10;q10) normal phenotype but clinical consequences

45,XX,rob(14;21)(q10;q10) Loss of the short arm(s) of chromosomes 14 and 21 Normal phenotype

Risk to future offspring ? der (14;21)(q10;q10) Trisomy 14 ? Trisomy 21 ? 50 % ? 14 21

pachytene

alternate segregation pachytene alternate segregation balanced normal gametes zygotes balanced normal

adjacent segregation trisomy 21 gametes zygotes monosomy 21 disomy 21 gametes zygotes monosomy 21 nullosomy 21 miscarriage

46,XY,der(14;21)(q10;q10),+21 trisomy 21

adjacent segregation trisomy 14 gametes zygotes monosomy 14 disomy 14 miscarriage monosomy 14 nullosomy 14 miscarriage

Genetic counseling der(14;21)(q10q10) the majority of the familial trisomy 21 (1/2 de novo ; 1/2 inherited) different risk when maternally or paternally inherited Maternally inherited : trisomy 21 risk: 15 % Paternally inherited : trisomy 21 risk : 2 %

Genetic counseling der(21;21)(q10;q10) Rarely inherited When inherited: 100% risk of trisomy 21 in the offspring

Genetic counseling der(13;14)(q10;q10) frequent (~ 1/1200) low risk: trisomy 13 ( ~ 1%)

45,XY,der(13;14)(q10:q10)

Structural anomalies Only one chromosome involved One breakage: terminal deletion Two breakages: one arm: interstitial deletion paracentric inversion two arms: pericentric inversion ring chromosome isochromosome Two chromosome involved Robertsonian translocation Reciprocal translocation

Translocations (t) fusion t(6;18)(p24;q21.2) Two breakpoints located on two different chromosomes followed by an exchange: reciprocal translocation fusion t(6;18)(p24;q21.2)

Reciprocal translocations Normal phenotype when balanced When abnormal phenotype (rarely): Gene interrupted at one of the breakpoint microdeletion or microduplication Breakpoint anomaly

46,XX,t(11;22)(q23.3;q11.2)

Reciprocal translocations t (11;22)(q23.3;q11.2) 11 22

Electronic microscopy Reciprocal translocations 46,XX,t(11;22)(q23.3;q11.2) Electronic microscopy Pachytene stage

Different modes of segregations alternate adjacent 1 adjacent 2 segregations 3:1 4 possible combinations segregation 4:0 Number of gametes in theory 16 possible combinations but not equal

Alternate segregation normal gamete balanced gamete pachytene

Partial monosomy and trisomy Adjacent 1 segregation pachytene gametes Partial monosomy and trisomy zygotes trisomy 11q dist. monosomy 22q dist. trisomy 22q dist. monosomy 11q dist.

You see a 25 years old patient for sterility without any anomalies You see a 25 years old patient for sterility without any anomalies. His karyotype is 45,XY,rob(14;21)(q10;q10) How do you interpret this result ?

Robertsonian translocations Involve two acrocentric chromosomes

Among the autosomes, 5 pairs of acrocentric chromosomes : 13, 14, 15, 21 and 22 6 7 8 9 10 11 12 13 14 15 16 17 18 X Y 19 20 21 22

Robertsonian translocations Involve two acrocentric chromosomes Breakpoints located at the centromere or close to Loss of the short arms Loss of a centromere Karyotype with 45 chromosomes Consequences in meiosis

Robertsonian translocations (rob ou der) fusion loss rob(13;14)(q10;q10) ou der(13;14)(q10;q10) normal phenotype but clinical consequences

45,XX,rob(14;21)(q10;q10) Loss of the short arm(s) of chromosomes 14 and 21 Normal phenotype