Diversity generating reverse transcriptase Reverse transcriptase an enzyme.

Slides:



Advertisements
Similar presentations
Phage BruceB, cluster G Et2Brutus, cluster A2.
Advertisements

Genomics – The Language of DNA Honors Genetics 2006.
Functional Site Prediction Selects Correct Protein Models Vijayalakshmi Chelliah Division of Mathematical Biology National Institute.
Five Classes of Introns
Short Dispersed Repeats KALEIGH, MARIAM, MICHAEL AND NICHOLAS.
Molecular Genetics DNA RNA Protein Phenotype Genome Gene
1 Computational Molecular Biology MPI for Molecular Genetics DNA sequence analysis Gene prediction Gene prediction methods Gene indices Mapping cDNA on.
Viral & Prokaryotic Genetics “Simple” Model Systems.
CENTER FOR BIOLOGICAL SEQUENCE ANALYSISTECHNICAL UNIVERSITY OF DENMARK DTU Homology Modeling Anne Mølgaard, CBS, BioCentrum, DTU.
Protein-DNA interactions: amino acid conservation and the effects of mutations on binding specificity Nicholas M. Luscombe and Janet M. Thornton JMB (2002)
Prediction of NO Oxidizable Cysteines Larry Grant Dr. Jamil Momand Cal State L.A.
. Protein Structure Prediction [Based on Structural Bioinformatics, section VII]
Protein Modules An Introduction to Bioinformatics.
DNA Replication When a cell or organism reproduces, a complete set of genetic instructions must pass from one generation to the next.
Genomics and bioinformatics summary 1. Gene finding: computer searches, cDNAs, ESTs, 2.Microarrays 3.Use BLAST to find homologous sequences 4.Multiple.
© Wiley Publishing All Rights Reserved. Biological Sequences.
Identifying recombination events in phage Giles through presence of repeat sequences MEGAN MAIR.
Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
google. com/search
Identifying New Motifs in Class 3 Inteins Mobile Elements.
Mutations Mutation- a change in the DNA nucleotide sequence
Protein Evolution and Sequence Analysis Protein Evolution and Sequence Analysis.
What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.
Yersinia Palindromic Sequences Introduction to Bioinformatics 301 April 30th, 2015 Jordan Davis.
Multiple Alignment and Phylogenetic Trees Csc 487/687 Computing for Bioinformatics.
Genome Alignment. Alignment Methods Needleman-Wunsch (global) and Smith- Waterman (local) use dynamic programming Guaranteed to find an optimal alignment.
5.3 – Advances in Genetics Trashketball!. Selecting organisms with desired traits to be parents of the next generation is… A. Inbreeding A. Inbreeding.
DNA to Protein – 12 Part one AP Biology. What is a Gene? A gene is a sequence of DNA that contains the information or the code for a protein or an RNA.
DNA Structure & Function Chapter 13. DNA Structure & Function 2 Mr. Karns Genetic Material  Transformation DNA Structure  Watson and Crick DNA Replication.
Classwork II: NJ tree using MEGA. 1.Go to CDD webpage and retrieve alignment of cd00157 in FASTA format. 2.Import this alignment into MEGA and convert.
Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.
Mysterious Sequence Repeats in Phage Genomes AKHIL GARG BNFO 301 APRIL 30, 2015.
Analysis and comparison of very large metagenomes with fast clustering and functional annotation Weizhong Li, BMC Bioinformatics 2009 Present by Chuan-Yih.
1 From Mendel to Genomics Historically –Identify or create mutations, follow inheritance –Determine linkage, create maps Now: Genomics –Not just a gene,
Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.
I Ia II Ib I IaIb IIIII IV V VI Figure S1. Comparison of amino acid sequence of O. sativa (Os) SUV3 (1-579) with SUV3 from A. thaliana (At) (1-571), H.
Doug Raiford Phage class: introduction to sequence databases.
Comparative methods Basic logics: The 3D structure of the protein is deduced from: 1.Similarities between the protein and other proteins 2.Statistical.
Farah Dahman Bioinformatics 301 MOBILE ELEMENTS EXISTENCE IN MYCOBACTERIOPHAGES.
A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.
Bioinformatics A Summary seminar (with many hints for exam questions)
1 4. Nucleic acids and proteins in one and more dimensions - second part.
Prepared By: Syed Khaleelulla Hussaini. Outline Proteins DNA RNA Genetics and evolution The Sequence Matching Problem RNA Sequence Matching Complexity.
Genomics Lecture 3 By Ms. Shumaila Azam. Proteins Proteins: large molecules composed of one or more chains of amino acids, polypeptides. Proteins are.
BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.
Scratch Protein Predictor Result Q:S and percent identity with Lore
Homework #1 is posted and due 9/20
Genomes and Their Evolution
Allan J. Somers, Elizabeth Rutledge PhD., Salish Kootenai College
Protein Sequence Alignments
Symposium on Applied Bioinformatics
Genome Projects Maps Human Genome Mapping Human Genome Sequencing
Mark M Metzstein, H.Robert Horvitz  Molecular Cell 
Sequence and comparison of the SDS protein.
Prediction of protein structure
Chapter 11.6 When it all goes Wrong
Volume 12, Issue 1, Pages (March 2004)
CHAPTER 17 FROM GENE TO PROTEIN.
Where would you draw the polyA tail in the gene above?______________
Biology, 9th ed,Sylvia Mader
Volume 92, Issue 1, Pages 1-4 (January 1998)
Finding a basis for flipping bases
.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 3 Gene Prediction and Annotation 4 Genome Structure 5 Genome.
Phylogenetic analysis and amino acid sequences comparison of HO endonucleases. Phylogenetic analysis and amino acid sequences comparison of HO endonucleases.
The family of bone morphogenetic proteins
Alignment of the deduced amino acid sequences of the myosin light chain 2 (MLC2) proteins. Alignment of the deduced amino acid sequences of the myosin.
Comparison of the predicted amino acid sequences of murine Rin (GenBank accession number U71202), human Rin (U71204), murine Rit (U71205), human Rit (U71203),
Conserved motifs in the ABC
Sequence alignment of colicin lysis proteins.
Presentation transcript:

Diversity generating reverse transcriptase Reverse transcriptase an enzyme

Phage tail fiber Unknown protein Reverse transcriptase BPP Substitutions in action Directed by initiation of mutagenic homing

Alignment of BPP's VR vs TR

1 in every million replications

BIP BMP

Not great identity but similar function Phage Tail fiber Unidentified protein Reverse Transcriptase TR VR Same Downstream order as in bordetella phages

TR VS VR in VHML What does it do??????????????

Vibrio phage with similar reverse transcriptase Vibrio phage with similar sequence but no reverse transcriptase

Understanding Phylogeny and Predicting New Class III Inteins Mobile Elements

Inteins – What are they? IntronsInteins

Tori et al (2010). J Biol Chem 285: HX amino acid HO-… Serine HO-CH 3 -… Threonine HS-CH 3 -… Cysteine Classes of Inteins (per splicing mechanism) Begins with Ser, Thr, or Cys

Class IClass II Tori et al (2010). J Biol Chem 285: Classes of Inteins (per splicing mechanism) Begins with Ser, Thr, or Cys Doesn't begin with Ser, Thr, or Cys HX amino acid HO-… Serine HO-CH 3 -… Threonine HS-CH 3 -… Cysteine

Class IClass IIClass III Tori et al (2010). J Biol Chem 285: Classes of Inteins (per splicing mechanism) Begins with Ser, Thr, or Cys Doesn't begin with Ser, Thr, or Cys Uses embedded Ser, Thr, or Cys HX amino acid HO-… Serine HO-CH 3 -… Threonine HS-CH 3 -… Cysteine

Tori et al (2010). J Biol Chem 285: How to recognize classes by sequence characteristics? Class IClass IIClass III Classes of Inteins (per splicing mechanism) Begins with Ser, Thr, or Cys Doesn't begin with Ser, Thr, or Cys Uses embedded Ser, Thr, or Cys

Recognition by conserved amino acid residues.

Recognition by conserved motifs.

Certain inteins are more similar than others.

What about extien similarity? Known inteins ????????? DnaB Intein Jumped in here?

Acknowledgements. This work would not have been possible without the support of: Jeff Elhai Raiha Tahir Mobile Elements Group

Farah Dahman Bioinformatics 301 MOBILE ELEMENTS EXISTENCE IN MYCOBACTERIOPHAGES

5′-TTATC[a/t]GGGGT- 3’ MPEME1 MPEME2 HOW TO KNOW IF MOBILE ELEMENT FOUND “Mycobacteriophages BPs, Angel and Halo: comparative genomics reveals a novel class of ultra-small mobile genetic elements.”

Phages studied: Cluster F (average length- 57,422bp)  Fruit Loop, DotProduct, Ramsey, Yoshi, Boomer METHOD  

Run mobile element sequence through biobike into each bacteriophage TTATC[a/t]GGGGT Find closest match METHOD

Exact matches found in FruitLoop, Boomer, Yoshi Each has some form of end part of sequence, but not the TTAT piece Relatively close proximity of match within sequence compared to others Phages of Cluster F do share the same ultra small mobile elements

SAME 438 NUCLEOTIDES BUT DIFFERENT COORDINATES