HANNIE KREMER KNO & ANTROPOGENETICA
ANTROPOGENETICA – HUMAN GENETICS
Interpret DNA variation – monogenic and complex disorders Things we do Map diseases to chromosomes (position) - monogenic and complex disorders Interpret DNA variation – monogenic and complex disorders Understand the function of genes - pathogenesis Therapy 98% Identical 99,8% identical
Things we do Map diseases to chromosomes (position) - monogenic disorders Interpret DNA variation – monogenic and complex disorders Understand the function of genes - pathogenesis Therapy
MAP DISEASES TO CHROMOSOMES MONOGENIC DISORDERS
A B Linkage: If a gene and a marker are on the same chromosome they will segregate together UNLESS They are separated by recombination n * A B n *
A B A B * n * n B A B A * n n *
Robinow syndrome Short stature Wide-spaced eyes Short nose Small penis
Linkage interval Robinow syndroom cM Chromosoom 9q21-q22.3 D9S1842 2.8 D9S1781 2.1 ROR2 D9S197 0.6 D9S1816 max = 6.47 = 0 D9S1842 0.1 D9S280 1.4 D9S1851 D9S287 1.6 D9S176 Human Genetics Nijmegen
Robinow syndrome Ror2 null mouse Human Genetics Nijmegen Robinow syndrome Ror2 null mouse From DeChiara et al. Nature Genetics March 2000
MAP DISEASES TO CHROMOSOMES COMPLEX DISORDERS
Genotyping Single Nucleotide Polymorphisms (SNPs) > 1 SNP per >3 kb …cctcctagggttgcaaagcctccttggctatg… …cctcctagggttgcatagcctccttggctatg… Person B: Person A: Allel 1 Allel 2 ~ 1,000,000 SNPs
Whole genome association studies Diabetes type 1 Obesity ADHD 500,000 SNPs Whole genome association studies Diabetes type 1 Obesity ADHD 2000 cases 4000 controls SNPs indicate genes involved arrays Case control design Gene 1 Gene 2 Gene 3 Gene 4 …… Gene 30.000
Whole genome association study 500,000 SNPs Whole genome association study Obesitas 9000 cases 30000 controls BMI > 30 FTO gene arrays Case control design Frayling et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 316: 889-894, 2007.
Whole genome association study 500.000 SNPs Whole genome association study Obesitas 9000 cases 30000 controls BMI > 30 FTO gene arrays 35% +0 kg 50% +1.5 kg 15% +3.0 kg FTO gene
INTERPRET GENETIC VARIATION Sequence variation at a specific nucleotide Copy number variations (CNV)
p63 gene mutations in EEC syndrome TA-p63 TA SAM DNA binding Iso A315E L162P R313G Y163C D312H D312N Ins A Y192C (3) C269Y P309S C308S C308Y S272N V202M L248C C306R R279C (3) R279H (12) R279Q R304W (8) R304Q (14) R304P R204W (10) R204Q (7) R204L R227Q (8) R280C (6) R280H (2) R280S 29 Mutations in 90 families 28 missense 1 frameshift
Structure model of p63 DNA binding domain
276 copy number abnormalities in 100 patients with Mental Retardation How do we differentiate normal variation from causal changes?
Patient 1 Genomic profile obtained 250K SNP array Log 2 Patient/Control
de novo inherited variation Chromosome 1 Paient 1 Chromosome 15 Mother Father Chromosome 1 Chromosome 15
Next Generation sequencing Alex Hoischen Christian Gillisen Next Generation sequencing
1953 The complete genome of an individual by massively parallel DNA sequencing. Wheeler et al. Nature, April 2008 Here we report the DNA sequence of a diploid genome of a single individual, James D. Watson, sequenced to 7.4-fold redundancy in two months using massively parallel sequencing
Nature genetics Question of the year 2007 The sequencing of the equivalent of an entire human genome for $1,000 has been announced as a goal for the genetics community What would you do if this sequencing capacity were available immediately?
Can we look at the all EXons of the genOME? Exome sequencing! mapped reads formed contigs targeted exon(s) 1.) Sequence Capture 2.) Sequencing 3.) Mapping 4.) Mutation detection
ABI SOLID 600 million map-able 50bp reads 30Gb Roche 454 1 million map-able 500bp reads 500Mb
~10,000 non-synonymous coding variants* * Per individual genome ~3,000,000 SNP variants* ~1,000,000 CNVs* To understand human health and disease we have to understand all types of genomic variation: ~4,000,000 variants ~10,000 non-synonymous coding variants*
Focus on de novo disease 4 DNAs from patients with Schinzel-Giedion syndrome patient samples n=14 4 human exomes: 2.5Gb output per sample
Alex Hoischen Bregje van Bon Christian Gillisen De novo mutations of SETBP1 cause Schinzel-Giedion syndrome in 13 patients Alexander Hoischen*, Bregje WM van Bon*, Christian Gilissen*, Peer Arts, Bart van Lier, Marloes Steehouwer, Petra de Vries, Rick de Reuver, Geert Mortier, Koen Devriendt, Marta Z Amorim, Nicole Revencu, Alexa Kidd, Mafalda Barbosa, Anne Turner, Janine Smith, Christina Oley, Alex Henderson, Ian M Hayes, Elizabeth M Thompson, Han G Brunner, Bert BA de Vries, Joris A Veltman Nature Genetics
Things we do Map diseases to chromosomes (position) - monogenic disorders Interpret DNA variation – monogenic and complex disorders Understand the function of genes - pathogenesis Therapy
Photoreceptor cilium protein complex Retinitis Pigmentosa RPGR
* Photoreceptor cilium protein complex Arl3 RP2 lebercilin CC2D2A RPGR PDE-δ Arl3 RP2 β-tubulin NPHP2 inversin * lebercilin nephrocystin-3 NPHP1 nephrocystin-1 NPHP5 IQCB1 NPHP3 CC2D2A NPHP4 nephrocystin-4 RPGR Dynein RPGRIP1L CEP290 RPGRIP1
* LCA RP LCA Photoreceptor cilium protein complex Senior Loken PDE-δ Arl3 RP2 β-tubulin LCA NPHP2 inversin Nephron - ophthisis * Joubert lebercilin nephrocystin-3 NPHP1 nephrocystin-1 NPHP5 IQCB1 NPHP3 Joubert RP CC2D2A NPHP4 nephrocystin-4 RPGR Dynein RPGRIP1L CEP290 RPGRIP1 Joubert / Meckel LCA LCA / Joubert / Meckel
GENETICA VAN GEHOORVERLIES ROL VAN BIOINFORMATICA
AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50 % inherited 50% environmental Ototoxic drugs Acustic trauma Infections 70% Nonsyndromic 30% Syndromic Usher Alport Pendred Norrie Waardenburg Branchio-Oto-Renal Jervell and Lange-Nielsen ~%77 AR ~%77 AR ~%22 AD ~%22 AD ~%1 X-linked <%1 Mitochondrial Known Genes 21 6 16 6
Vraag van patiënt naar de oorzaak beantwoorden: WAAROM IS HET OPHELDEREN VAN OORZAKEN VAN ERFELIJKE ZIEKTEN BELANGRIJK? Vraag van patiënt naar de oorzaak beantwoorden: is het erfelijk - erfelijkheidsadvies Vroege diagnostiek van familieleden – goede begeleiding Inzicht in genen/eiwitten die essentieel zijn voor ontwikkeling en functie van het binnenoor Handvaten voor therapie
FAMILIE TR57
DFNB63 LOCUS TR57 26 bekende of voorspelde genen ~5.29 Mb DFNB63 15.5 15.4 DFNA32 15.3 TR57 FT1A-G PKDF702 DFNB63 FT2 1.03 Mb 15.2 15.1 USH1C 14.3 14.2 D11S2371 D11S1337 D11S4179 D11S1291 D11S916 D11S1314 D11S4139 D11S4136 D11S4113 D11S987 14.1 13 26 bekende of voorspelde genen DFNB51 12 11.2 11.12 11.11 11 12.1 ~5.29 Mb 12.2 12.3 DFNB63 13.1 FGF3 13.2 13.3 DFNB63 13.4 13.5 MYO7A 14.1 14.2 14.3 21 22.1 22.2 22.3 23.1 DFNB24 23.2 23.3 TECTA 24.1 24.2 24.3 25 DFNB20
LRTOMT KARAKTERISATIE Genome browser build 36.1 LRTOMT1 LRTOMT2
EFFECT VAN MUTATIES Catechol-O-methyltransferase domein A215A G163VfsX4 (c.358+4G>A) 3’ UTR E110K A29SfsX54 (c.358+4G>A) W105R R81Q Catechol-O-methyltransferase domein
MOLECULAR MODELING
EFFECT VAN MISSENSE MUTATIES
HET BINNENOOR
SAMENVATTING Bioinformatica is essentieel voor verschillende stappen in studies naar ziektegenen De structuur en functie van het humane genoom en genen zijn nog lang niet in kaart gebracht De oorzaak van DFNB63 is gelegen in defecten in het LRTOMT gen. Het precieze effect van mutaties in dit gen op de functie van het binnenoor is nog niet duidelijk.