Polymerase Chain Reaction (PCR)

Slides:

Advertisements

Similar presentations

PCR way of copying specific DNA fragments from small sample DNA material "molecular photocopying" It’s fast, inexpensive and simple Polymerase Chain Reaction.

Advertisements

Polymerase Chain Reaction (PCR). PCR produces billions of copies of a specific piece of DNA from trace amounts of starting material. (i.e. blood, skin.

Recombinant DNA technology

Generating the histone code CDK8 kinases histones to repress transcription.

Primer/probe design Crucial for successful DNA & RNA analysis! Main source of specificity for PCR.

COMPUTER EXERCISE Design of PCR and PCR-RFLP experiments This presentation shows all steps of a PCR-RFLP experiment and is a companion of the computer.

Lab 8: PCR (Polymerase Chain Reaction)

General Genetics. PCR 1.Introduce the students to the preparation of the PCR reaction. PCR 2.Examine the PCR products on agarose gel electrophoresis.

Genomic DNA purification

Bioinformatics/PCR Lab How does having a certain genetic marker affect chances of getting brain cancer?

Polymerase Chain Reaction

Polymerase Chain Reaction

KEYS Lab Training DNA Barcoding: Identification of Species

Biotechnology. Comparative genomics also has been used to identify recently mobilized transposons in genetically diverse humans. For example, over 600.

Ch. 13.4: DNA Technology Applications

Recombinant DNA Technology………..

Abstract Little is known about the reproductive habits of paddlefish, a threatened species in Wisconsin and Minnesota. Biologists studying paddlefish spawning.

PV92 PCR/Informatics Kit

DNA Cloning and PCR.

Amplifying DNA. The Power of PCR View the animation at

Chapter 14: DNA Amplification by Polymerase Chain Reaction.

Polymerase Chain Reaction PCR. PCR allows for amplification of a small piece of DNA. Some applications of PCR are in: –forensics (paternity testing, crimes)

PCR Forensics. Today’s Lab There has been an outbreak of Salmonella poisoning in the Student Union cafeteria at Stanford University cafeteria. You have.

Polymerase Chain Reaction (PCR) Developed in 1983 by Kary Mullis Major breakthrough in Molecular Biology Allows for the amplification of specific DNA fragments.

POLYMERASE CHAIN REACTION (PCR) Bridges Polymerase Chain Reaction  Simple reaction  Produces many copies of a specific fragment of DNA  Live.

©2001 Timothy G. Standish Romans 5:17 17For if by one man’s offence death reigned by one; much more they which receive abundance of grace and of the gift.

Success criteria - PCR By the end of this lesson we will be able to: 1. The polymerase chain reaction (PCR) is a technique for the amplification ( making.

Ancient Lake non-isolated pothole River where pupfish can swim from pothole to pothole. isolated potholes Hypothesis is that there was an ancient lake.

Polymerase Chain Reaction (PCR)

Human Genomics. Writing in RED indicates the SQA outcomes. Writing in BLACK explains these outcomes in depth.

Polymerase Chain Reaction A process used to artificially multiply a chosen piece of genetic material. May also be known as DNA amplification. One strand.

Detection of the human VNTR using PCR* *A Polymerase Chain Reaction Experiment.

Polymerase Chain Reaction (PCR). PCRPCR PCR produces billions of copies of a specific piece of DNA from trace amounts of starting material. (i.e. blood,

Crime Scene Investigator PCR Basics™

FOOTHILL HIGH SCHOOL SCIENCE DEPARTMENT Chapter 13 Genetic Engineering Section 13-2 Manipulating DNA.

Introduction to PCR Polymerase Chain Reaction

The microbial world S. Cerevisiae (yeast) Mycobacterium tuberculosis.

Polymerase Chain Reaction (PCR). What’s the point of PCR? PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA PCR allows you.

CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson © 2014 Pearson Education, Inc. TENTH EDITION CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky.

Polymerase Chain Reaction (PCR): DNA Replication in vitro DNA replication in vivo DNA replication in vivo –Occurs in S-phase –Helicase, primers, DNA polymerase.

CATEGORY: EXPERIMENTAL TECHNIQUES Polymerase Chain Reaction (PCR) Tarnjit Khera, University of Bristol, UK Background The polymerase chain reaction (PCR)

PCR Polymerase chain reaction. PCR is a method of amplifying (=copy) a target sequence of DNA.

GoTaq DNA Polymerase GoTaq Flexi DNA Polymerase GoTaq Green Master Mix GoTaq Green Hot Start Master Mix GoTaq Colorless Master Mix GoTaq Colorless Hot.

The Polymerase Chain Reaction 1. The polymerase chain reaction in outline outline 2. PCR in more detail 3. Applications of PCR.

PCR Polymerase Chain Reaction Parviz Fallah Stem Cell Technology Research Centre.

The stroke size should be 0.25

Introduction to PCR Polymerase Chain Reaction

Mahmuda Akter, Paige Fairrow-Davis, and Rebecca Seipelt-Thiemann

Part 3 Gene Technology & Medicine

Lab 8: PCR (Polymerase Chain Reaction)

Success criteria - PCR By the end of this lesson we will be know:

Polymerase Chain Reaction

PCR Basics A review.

Microbial Genomes and techniques for studying them.

Jeopardy Final Jeopardy Gene Cloning Plasmids Ligase PCR $100 $100

Polymerase Chain Reaction (PCR)

Midterm Review Feb

PCR Polymerase Chain Reaction

Polymerase Chain Reaction

Polymerase Chain Reaction

PCR and RLFP’s.

Polymerase Chain Reaction & DNA Profiling

Polymerase Chain Reaction

Polymerase Chain Reaction

Chapter 14 Bioinformatics—the study of a genome

Sequencing and Copying DNA

Introduction to Polymerase Chain Reaction (PCR)

3.5 Genetic modification and biotechnology

Thanks to Dr. Pierre Laneuville and

SBI4U0 Biotechnology.

Presentation transcript:

Polymerase Chain Reaction (PCR)

Recap from last week So, we've extracted DNA from whole anemones, some of which (the unbleached ones) contained symbiont DNA. Sampled extractions contain DNA and are reasonably clean. So, now we have a small amount of all of the genomic DNA. But how do we get enough of our regions of interest to study them? Polymerase chain reaction (PCR) amplifies target regions of genomic DNA.

PCR programs and ingredients PCR ingredients: Buffer (TRIS, KCl, MgCl2) necessary for polymerase activity Taq polymerase enzyme dNTPs the monomers of DNA Template DNA your samples!

The TRP family: Transient Receptor Potential channels TRP channels are family of gated ion channels in animals (~30 present, depending on species) TRP channels gated by a variety of stimuli including temperature and ligands (i.e. molecules) including menthol and capsaicin

Finding TRPA1s We know TRPA1s are a menthol receptor, and we know that menthol bleaches anemones. Could TRPA1 signaling affect downstream activities that are involved in bleaching? How do we find out if our anemones have TRPA1?

Types of homology: orthology and parlogy

pBLAST: protein basic local alignment search tool Known TRPA1 sequences were BLASTED against the genome of Exaiptasia pallida, yielding hundreds of partial matches. The best matches were checked for the presence of the menthol binding domain, and primers were designed to assay diversity among our genets across that region of DNA.

Example gene model

Symbiodinium 23S PCR 23S codes for ribosomal RNA PCR for Symbiodinium chloroplast 23S 23S_F-Forward_Overhang: TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGAATAACGACCTGCATGAAAC 23S_R-Reverse_Overhang: GTCTCGTGGGCTCGGAGATGTGTATAAGAGA CAGGCCTGTTATCCGTAGAGTAGC Product ~500bp

Goals Amplify the Breviolum 23S and 3 putative Exaiptasia TRPA1 sequences Confirm the reaction was successful by gel electrophoresis and then sequence the amplicons. Determine if genetic diversity across these loci corresponds to phenotypic diversity observed in stress tolerance.

Mixes and program PCR program TRP reaction mix 1: 94C 1:30 2: 94C 0:30 5: Go to 2 (34x) 6: 72C 5:00 7: 4C forever *23S annealing is 56C TRP reaction mix 23ul 2x GoTaq + H2O (12.5ul GoTaq, 10.5ul H2O, premixed) 1ul appropriate primers 1ul template DNA 23S reaction mix 23ul 2x GoTaq + MgCl2 + H2O (12.5ul GoTaq, 1.5ul 25mM MgCL2, 9ul H2O, premixed) 1ul 23S F/R 1ul template DNA (use control sample for this one)