Comments on bipartitions, quartets and supertrees

Slides:



Advertisements
Similar presentations
A Separate Analysis Approach to the Reconstruction of Phylogenetic Networks Luay Nakhleh Department of Computer Sciences UT Austin.
Advertisements

Phylogenetic Tree A Phylogeny (Phylogenetic tree) or Evolutionary tree represents the evolutionary relationships among a set of organisms or groups of.
Phylogenetics - Distance-Based Methods CIS 667 March 11, 2204.
Phylogenetic reconstruction
Phylogenetic trees Sushmita Roy BMI/CS 576 Sep 23 rd, 2014.
A Web Interface to analyse SOM of Bipartitions of Gene Phylogenies - A Walk Through J. Peter Gogarten, Maria Poptsova Dept. of Molecular and Cell Biology.
New Tools for Visualizing Genome Evolution Lutz Hamel Dept. of Computer Science and Statistics University of Rhode Island J. Peter Gogarten Dept. of Molecular.
Molecular Evolution Revised 29/12/06
Sequence alignment: Removing ambiguous positions: Generation of pseudosamples: Calculating and evaluating phylogenies: Comparing phylogenies: Comparing.
Sequence alignment: Removing ambiguous positions: Generation of pseudosamples: Calculating and evaluating phylogenies: Comparing phylogenies: Comparing.
MCB 5472 Gene Families, Super Trees and Super Matrices Peter Gogarten Office: BSP 404 phone: ,
Phylogeny. Reconstructing a phylogeny  The phylogenetic tree (phylogeny) describes the evolutionary relationships between the studied data  The data.
The (Supertree) of Life: Procedures, Problems, and Prospects Presented by Usman Roshan.
Branches, splits, bipartitions In a rooted tree: clades (for urooted trees sometimes the term clann is used) Mono-, Para-, polyphyletic groups, cladists.
Bas E. Dutilh Phylogenomics Using complete genomes to determine the phylogeny of species.
Example of bipartition analysis for five genomes of photosynthetic bacteria (188 gene families) total 10 bipartitions R: Rhodobacter capsulatus, H: Heliobacillus.
. Class 9: Phylogenetic Trees. The Tree of Life D’après Ernst Haeckel, 1891.
Cenancestor (aka LUCA or MRCA) can be placed using the echo remaining from the early expansion of the genetic code. reflects only a single cellular component.
MCB 372 #12: Tree, Quartets and Supermatrix Approaches Collaborators: Olga Zhaxybayeva (Dalhousie) Jinling Huang (ECU) Tim Harlow (UConn) Pascal Lapierre.
MCB 372 #14: Student Presentations, Discussion, Clustering Genes Based on Phylogenetic Information J. Peter Gogarten University of Connecticut Dept. of.
Phylogenetic trees Sushmita Roy BMI/CS 576
MCB5472 Computer methods in molecular evolution Lecture 3/22/2014.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Molecular phylogenetics
Coalescence and the Cenancestor J. Peter Gogarten University of Connecticut Department of Molecular and Cell Biology.
SuperTriplets: a triplet-based supertree approach to phylogenomics Vincent Ranwez, Alexis Criscuolo and Emmanuel J.P. Douzery.
MCB5472 Computer methods in molecular evolution Lecture 4/21/2014.
MCB 3421 class 25. student evaluations Please follow this link to the on-line surveys that are open for you this semester.
Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.
BINF6201/8201 Molecular phylogenetic methods
3- RIBOSOMAL RNA GENE RECONSTRUCITON  Phenetics Vs. Cladistics  Homology/Homoplasy/Orthology/Paralogy  Evolution Vs. Phylogeny  The relevance of the.
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
Building and visualizing phylogeny Henrik Lantz Dept. of Medical Biochemistry and Microbiology, BMC, Uppsala University.
OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all.
Building phylogenetic trees. Contents Phylogeny Phylogenetic trees How to make a phylogenetic tree from pairwise distances  UPGMA method (+ an example)
The bootstrap, consenus-trees, and super-trees Phylogenetics Workhop, August 2006 Barbara Holland.
Phylogenetic analyses of cyanobacterial genomes: Quantification of horizontal gene transfer events Olga Zhaxybayeva, J. Peter Gogarten, Robert L. Charlebois,
Molecular Phylogeny. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.
Phylogenetic Analysis Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics Figures from Higgs & Attwood.
Phylogenetic trees Sushmita Roy BMI/CS 576 Sep 23 rd, 2014.
MCB 3421 class 26.
Phylogeny & Systematics
Bayes’ Theorem Reverend Thomas Bayes ( ) Posterior Probability represents the degree to which we believe a given model accurately describes the.
Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?
1 CAP5510 – Bioinformatics Phylogeny Tamer Kahveci CISE Department University of Florida.
SupreFine, a new supertree method Shel Swenson September 17th 2009.
Application of Phylogenetic Networks in Evolutionary Studies Daniel H. Huson and David Bryant Presented by Peggy Wang.
Phylogenetic trees. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.
Darwin’s Tree of Life, July million species Phylogenetic inference from genomic.
Phylogenetic genome analysis, phylogenomics
MCB 3421 class 26.
Phylogenetic basis of systematics
Figure 1. Recent estimates of Neoaves phylogeny. a) The Jarvis et al
Phylogenomic Analysis of Spiders Reveals Nonmonophyly of Orb Weavers
Patterns in Evolution I. Phylogenetic
Phylogenetic Trees.
Molecular Evolution.
Volume 21, Issue 3, Pages (October 2017)
Hox genes and the phylogeny of the arthropods
Chapter 19 Molecular Phylogenetics
Volume 21, Issue 3, Pages (October 2017)
Genomic comparison of thermotolerance islands.
Molecular data assisted morphological analyses
Gautam Dey, Tobias Meyer  Cell Systems 
(A, left) Radial cladogram based on RAxML-based maximum-likelihood phylogeny (500 bootstraps, gamma distribution model, and LG+F substitution model) constructed.
Phylogenetic tree based on 16S rRNA gene sequence comparisons over 1,260 aligned bases showing the relationship between species of the genus Actinomyces.
Phylogenetic tree of 38 Pseudomonas type strains, based on the V3-V5 region sequence of the 16S rRNA gene (V3 primer, positions 442 to 492; and V5 primer,
Core genome phylogeny of V. anguillarum strains.
Phylogenetic tree of 38 Pseudomonas type strains, based on a concatenated nine-gene MLST analysis. Phylogenetic tree of 38 Pseudomonas type strains, based.
Phylogenetic comparison among selected Pasteurella multocida and Haemophilus influenzae species with completed genome sequences. Phylogenetic comparison.
Presentation transcript:

Comments on bipartitions, quartets and supertrees MCB 5472 Comments on bipartitions, quartets and supertrees

student evaluations Please go to husky CT and complete student evaluations !

From: Delsuc F, Brinkmann H, Philippe H. Phylogenomics and the reconstruction of the tree of life. Nat Rev Genet. 2005 May;6(5):361-75.

Supertree vs. Supermatrix Trends Ecol Evol. 2007 Jan;22(1):34-41 The supermatrix approach to systematics Alan de Queiroz John Gatesy: From: Schematic of MRP supertree (left) and parsimony supermatrix (right) approaches to the analysis of three data sets. Clade C+D is supported by all three separate data sets, but not by the supermatrix. Synapomorphies for clade C+D are highlighted in pink. Clade A+B+C is not supported by separate analyses of the three data sets, but is supported by the supermatrix. Synapomorphies for clade A+B+C are highlighted in blue. E is the outgroup used to root the tree.

Johann Heinrich Füssli Odysseus vor Scilla und Charybdis From: http://en.wikipedia.org/wiki/File:Johann_Heinrich_F%C3%BCssli_054.jpg

B) Generate 100 datasets using Evolver with certain amount of HGTs A) Template tree C) Calculate 1 tree using the concatenated dataset or 100 individual trees D) Calculate Quartet based tree using Quartet Suite Repeated 100 times…

Supermatrix versus Quartet based Supertree inset: simulated phylogeny

From: Lapierre P, Lasek-Nesselquist E, and Gogarten JP (2012) Note : Using same genome seed random number will reproduce same genome history From: Lapierre P, Lasek-Nesselquist E, and Gogarten JP (2012) The impact of HGT on phylogenomic reconstruction methods Brief Bioinform [first published online August 20, 2012] doi:10.1093/bib/bbs050

HGT EvolSimulator Results

See http://bib. oxfordjournals. org/content/15/1/79 See http://bib.oxfordjournals.org/content/15/1/79.full for more information.

Decomposition of Phylogenetic Data Phylogenetic information present in genomes Break information into small quanta of information Analyze spectra to detect transferred genes and plurality consensus.

TOOLS TO ANALYZE PHYLOGENETIC INFORMATION FROM MULTIPLE GENES IN GENOMES: Bipartition Spectra (Lento Plots)

BIPARTITION OF A PHYLOGENETIC TREE Bipartition (or split) – a division of a phylogenetic tree into two parts that are connected by a single branch. It divides a dataset into two groups, but it does not consider the relationships within each of the two groups. Yellow vs Rest * * * . . . * * 95 compatible to illustrated bipartition Orange vs Rest . . * . . . . * * * * . . . . . incompatible to illustrated bipartition

“Lento”-plot of 34 supported bipartitions (out of 4082 possible) 13 gamma- proteobacterial genomes (258 putative orthologs): E.coli Buchnera Haemophilus Pasteurella Salmonella Yersinia pestis (2 strains) Vibrio Xanthomonas (2 sp.) Pseudomonas Wigglesworthia There are 13,749,310,575 possible unrooted tree topologies for 13 genomes

Consensus clusters of eight significantly supported bipartitions Phylogeny of putatively transferred gene (virulence factor homologs (mviN)) only 258 genes analyzed

“Lento”-plot of supported bipartitions (out of 501 possible) 10 cyanobacteria: Anabaena Trichodesmium Synechocystis sp. Prochlorococcus marinus (3 strains) Marine Synechococcus Thermo- synechococcus elongatus Gloeobacter Nostoc punctioforme Number of datasets Based on 678 sets of orthologous genes Zhaxybayeva, Lapierre and Gogarten, Trends in Genetics, 2004, 20(5): 254-260.

Bootstrap support values for embedded quartets + : tree calculated from one pseudo-sample generated by bootstraping from an alignment of one gene family present in 11 genomes : embedded quartet for genomes 1, 4, 9, and 10 . This bootstrap sample supports the topology ((1,4),9,10). 1 9 1 9 1 10 4 10 10 4 9 4  Zhaxybayeva et al. 2006, Genome Research, 16(9):1099-108 Quartet spectral analyses of genomes iterates over three loops: Repeat for all bootstrap samples. Repeat for all possible embedded quartets. Repeat for all gene families.

Illustration of one component of a quartet spectral analyses Summary of phylogenetic information for one genome quartet for all gene families Total number of gene families containing the species quartet Number of gene families supporting the same topology as the plurality (colored according to bootstrap support level) Number of gene families supporting one of the two alternative quartet topologies

Quartet decomposition analysis of 19 Prochlorococcus and marine Synechococcus genomes. Quartets with a very short internal branch or very long external branches as well those resolved by less than 30% of gene families were excluded from the analyses to minimize artifacts of phylogenetic reconstruction.

Plurality consensus calculated as supertree (MRP) from quartets in the plurality topology.

NeighborNet (calculated with SplitsTree 4.0) Neighbor-net calculated as supertree (from the MRP matrix using SplitsTree 4.0) from all quartets significantly supported by all individual gene families (1812) without in-paralogs.

Phylogeny of delta subunit of ATP synthase.

C D C C D D A B B B A A B C C D C D D A A B A B B N=4(0) N=5(1) N=8(4) 0.01 0.01 N=4(0) N=5(1) N=8(4) 0.01 A 0.01 0.01 B B B A A B C C D C D D A A B A B B N=13(9) N=23(19) N=53(49) From: Mao F, Williams D, Zhaxybayeva O, Poptsova M, Lapierre P, Gogarten JP, Xu Y (2012) BMC Bioinformatics 13:123, doi:10.1186/1471-2105-13-123

Results : Maximum Bootstrap Support value for Bipartition separating (AB) and (CD) Maximum Bootstrap Support value for embedded Quartet (AB),(CD)

Bipartition Paradox: The more sequences are added, the lower the support for bipartitions that include all sequences. The more data one uses, the lower the bootstrap support values become. This paradox disappears when only embedded splits for 4 sequences are considered.