MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR BIOLOGY TECHNIQUES I. DNA isolation and fragmentation Recombinant DNA Gel electrophoresis Hybridization Southern blot, RFLP

MOLECULAR BIOLOGY – Molecular biology techniques 1866 1910 Mendel Morgan 1944 1953 Avery, MacLeod & McCarty Watson & Crick

NOT BAD WORK INSIDE 150 YEARS !!!! MOLECULAR BIOLOGY – Molecular biology techniques 1977 2004 human DNA: 3 200 000 000 letters Approx 25,000 genes filling 150x Sanger NOT BAD WORK INSIDE 150 YEARS !!!! Human genome sequence

MOLECULAR BIOLOGY – Molecular biology techniques T A C C G T T A G T T C A C G A T T A T G G C A A T C A A G T G C T A A A U G G C A A U C A A G U G C U A A RNA START STOP GTTTATTGCATTCTTCTGTGAAAAGAAGCTGTTCACAGAATGATTCTGAAGAACCAACTT TGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTT CTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAA AACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCAGGAAGGACAGT GTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAG CATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGA AAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGG ATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACA AGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAA AGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTG AAAAATACATGAGAGTAGCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATC TAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATC CAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATG AAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAAACAGACTTGACTTGTG TAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAAC AAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAA ATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCT TGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCT TAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAA TCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAAC AATATCCTACTAGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAA AGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAG TTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATT TTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATTACAGAACTTTCTACTA TATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATAT TGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTG AGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAG ACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGA AAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTA GGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAG CTGTGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATC CAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAA ATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATA ATATTGAAATGACTACTGGCACTTTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATA CTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTG ATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGC TATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAA ACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAG How to study this amazing amount of information?

MOLECULAR BIOLOGY – Molecular biology techniques 1 ISOLATION OF DNA

0.5% SDS + proteinase K (55oC several hours) MOLECULAR BIOLOGY – Molecular biology techniques High MW Genomic DNA Isolation Typical Procedure Cell Lysis 0.5% SDS + proteinase K (55oC several hours) Phenol Extraction gentle rocking several hours Phenol Extraction mix sample with equal volume of sat. phenol soln retain aqueous phase optional chloroform/isoamyl alcohol extraction(s)  aqueous phase (nucleic acids)  phenolic phase (proteins) Digesting eucaryotic cells or tissues with proteinase K in the presence of EDTA to sequester divalent cations and thereby inhibit DNases. Solubilizing membranes and denaturing proteins with a detergent such as SDS. "Phenol and chloroform are both organic solvents, so lysed cell components that're hydrophobic will be trapped in these solvents, e.g. membrane lipids, hydrophobic polypeptide sequences (protein) or polysaccharides etc. etc. Both solvents are also powerful denaturants, therefore proteins will be denatured, leaving hydrophobic segments to interact with organic solvent and hydrophilic segment to interact with aqueous. This is why we see interphase (containing proteins or polysaccharides etc.) during organic extraction. At the end, it leaves only hydrophilic entities in the aqueous solution, e.g. nucleic acids, sugar, salt, etc. etc..." Using phenol is advantageous because it separate proteins well but the drawback is that it's a little soluble in water (aqueous), so at the end, it'll contaminate your DNA. AS for chloroform, it's immiscible to water, so by combining chloroform with phenol, both will separate proteins well and at the same time, chloroform will ensure phenol stay organic and not wandered of to aqueous phase. Sometimes, we just do chloroform-isoamyl alcohol separation because we really want to ensure there's no residual phenol that is still in aqueous phase. ORGANIC PHASE SEPARATION

MOLECULAR BIOLOGY – Molecular biology techniques High MW Genomic DNA Isolation Typical Procedure Cell Lysis 0.5% SDS + proteinase K (55oC several hours) Phenol Extraction gentle rocking several hours Ethanol/ salt Precipitation EtOH Precipitation 2-2.5 volumes EtOH, -20oC high salt, pH 5-5.5 centrifuge or ‘spool’ out RNAse followed by proteinase K 5 Repeat Phenol Extraction and EtOH ppt

PLASMID DNA Natural Bacterial Transformation/ conjugation MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA Natural Bacterial Transformation/ conjugation Also possible to experimentally ‘transform’ plasmid vectors into bacteria - see later S. Pneumoniae ‘transforming’ DNA is a plasmid

MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA ISOLATION Alkaline lysis denaturation/ renaturation protocol Bacteria lysed in SDS + strong NaOH buffer DENATURATION Protein denaturation (SDS) Single stranded plasmid DNA Single stranded genomic DNA Potassium acetate pH NEUTRALISATION SEDIMENTATION Centrifugation Aqueous (double stranded plasmid DNA) Pellet (proteins and genomic DNA) Small multi-copy plasmid DNA quickly re-anneals in solution Large single copy genomic DNA fails to re-anneal and forms precipitate with proteins Isolation of plasmid DNA Re-suspension The bacterial pellet is re-suspended in a solution (normally called solution I, or similar in the kits) containing Tris, EDTA, glucose and RNase A. Divalent cations (Mg2+, Ca2+) are essential for DNase activity and the integrity of the bacterial cell wall. EDTA chelates divalent cations in the solution preventing DNases from damaging the plasmid and also helps by destabilizing the cell wall. Glucose maintains the osmotic pressure so the cells don’t burst and RNase A is included to degrade cellular RNA when the cells are lysed. Lysis The lysis buffer (aka solution 2) contains sodium hydroxide (NaOH) and the detergent Sodium Dodecyl (lauryl) Sulfate (SDS). SDS is there to solubilize the cell membrane. NaOH helps to break down the cell wall, but more importantly it disrupts the hydrogen bonding between the DNA bases, converting the double-stranded DNA (dsDNA) in the cell, including the genomic DNA (gDNA) and your plasmid, to single stranded DNA (ssDNA). This process is called denaturation and is central part of the procedure, which is why it’s called alkaline lysis. SDS also denatures most of the proteins in the cells, which helps with the separation of the proteins from the plasmid later in the process. It is important during this step to make sure that the re-suspension and lysis buffers are well mixed, although not too vigorously (see below). Check out my article on 5 tips on vector preparation for gene cloning for more information and tips. Also remember that SDS and NaOH are pretty nasty so it’s advisable to wear gloves and eye protection when performing alkaline lysis. Neutralization Addition of potassium acetate (solution 3) returns the pH to neutral. Under these conditions the hydrogen bonding between the bases of the single stranded DNA can be re-established, so the ssDNA can re-nature to dsDNA. This is the selective part. While it is easy for the the small circular plasmid DNA to re-nature it is impossible to properly anneal those huge gDNA stretches. This is why it’s important to be gentle during the lysis step because vigorous mixing or vortexing will shear the gDNA producing shorter stretches that can re-anneal and contaminate your plasmid prep. While the double-stranded plasmid can dissolve easily in solution, the single stranded genomic DNA, the SDS and the denatured cellular proteins stick together through hydrophobic interactions to form a white precipitate. The precipitate can easily be separated from the plasmid DNA solution by centrifugation.

Quick relatively pure double stranded plasmid DNA MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) 1. Phenol/ CHCl3 extraction & Ethanol/ Salt precipitation or 2. Solid phase/ silica extraction ‘miniprep’ Pellet (proteins and genomic DNA) In presence of alkaline chaotropic salts, denatured plasmid DNA binds to silica beads in the column Isolation of plasmid DNA Re-suspension The bacterial pellet is re-suspended in a solution (normally called solution I, or similar in the kits) containing Tris, EDTA, glucose and RNase A. Divalent cations (Mg2+, Ca2+) are essential for DNase activity and the integrity of the bacterial cell wall. EDTA chelates divalent cations in the solution preventing DNases from damaging the plasmid and also helps by destabilizing the cell wall. Glucose maintains the osmotic pressure so the cells don’t burst and RNase A is included to degrade cellular RNA when the cells are lysed. Lysis The lysis buffer (aka solution 2) contains sodium hydroxide (NaOH) and the detergent Sodium Dodecyl (lauryl) Sulfate (SDS). SDS is there to solubilize the cell membrane. NaOH helps to break down the cell wall, but more importantly it disrupts the hydrogen bonding between the DNA bases, converting the double-stranded DNA (dsDNA) in the cell, including the genomic DNA (gDNA) and your plasmid, to single stranded DNA (ssDNA). This process is called denaturation and is central part of the procedure, which is why it’s called alkaline lysis. SDS also denatures most of the proteins in the cells, which helps with the separation of the proteins from the plasmid later in the process. It is important during this step to make sure that the re-suspension and lysis buffers are well mixed, although not too vigorously (see below). Check out my article on 5 tips on vector preparation for gene cloning for more information and tips. Also remember that SDS and NaOH are pretty nasty so it’s advisable to wear gloves and eye protection when performing alkaline lysis. Neutralization Addition of potassium acetate (solution 3) returns the pH to neutral. Under these conditions the hydrogen bonding between the bases of the single stranded DNA can be re-established, so the ssDNA can re-nature to dsDNA. This is the selective part. While it is easy for the the small circular plasmid DNA to re-nature it is impossible to properly anneal those huge gDNA stretches. This is why it’s important to be gentle during the lysis step because vigorous mixing or vortexing will shear the gDNA producing shorter stretches that can re-anneal and contaminate your plasmid prep. While the double-stranded plasmid can dissolve easily in solution, the single stranded genomic DNA, the SDS and the denatured cellular proteins stick together through hydrophobic interactions to form a white precipitate. The precipitate can easily be separated from the plasmid DNA solution by centrifugation. Wash buffers used to remove impurities & DNA eluted (and re-natured in H2O) Centrifugation steps Quick relatively pure double stranded plasmid DNA

Extremley pure double stranded plasmid DNA MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) or 3. Anion exchange column-based chromatography Pellet (proteins and genomic DNA) Isolation of plasmid DNA Re-suspension The bacterial pellet is re-suspended in a solution (normally called solution I, or similar in the kits) containing Tris, EDTA, glucose and RNase A. Divalent cations (Mg2+, Ca2+) are essential for DNase activity and the integrity of the bacterial cell wall. EDTA chelates divalent cations in the solution preventing DNases from damaging the plasmid and also helps by destabilizing the cell wall. Glucose maintains the osmotic pressure so the cells don’t burst and RNase A is included to degrade cellular RNA when the cells are lysed. Lysis The lysis buffer (aka solution 2) contains sodium hydroxide (NaOH) and the detergent Sodium Dodecyl (lauryl) Sulfate (SDS). SDS is there to solubilize the cell membrane. NaOH helps to break down the cell wall, but more importantly it disrupts the hydrogen bonding between the DNA bases, converting the double-stranded DNA (dsDNA) in the cell, including the genomic DNA (gDNA) and your plasmid, to single stranded DNA (ssDNA). This process is called denaturation and is central part of the procedure, which is why it’s called alkaline lysis. SDS also denatures most of the proteins in the cells, which helps with the separation of the proteins from the plasmid later in the process. It is important during this step to make sure that the re-suspension and lysis buffers are well mixed, although not too vigorously (see below). Check out my article on 5 tips on vector preparation for gene cloning for more information and tips. Also remember that SDS and NaOH are pretty nasty so it’s advisable to wear gloves and eye protection when performing alkaline lysis. Neutralization Addition of potassium acetate (solution 3) returns the pH to neutral. Under these conditions the hydrogen bonding between the bases of the single stranded DNA can be re-established, so the ssDNA can re-nature to dsDNA. This is the selective part. While it is easy for the the small circular plasmid DNA to re-nature it is impossible to properly anneal those huge gDNA stretches. This is why it’s important to be gentle during the lysis step because vigorous mixing or vortexing will shear the gDNA producing shorter stretches that can re-anneal and contaminate your plasmid prep. While the double-stranded plasmid can dissolve easily in solution, the single stranded genomic DNA, the SDS and the denatured cellular proteins stick together through hydrophobic interactions to form a white precipitate. The precipitate can easily be separated from the plasmid DNA solution by centrifugation. Altering the pH and ionic conditions removes impurities leading to high [salt] elution and EtOH or isopropanol precipitation Extremley pure double stranded plasmid DNA

Special Considerations MOLECULAR BIOLOGY – Molecular biology techniques Isolation of RNA Special Considerations Guanidinium thiocyanate RNAse inhibitors! extraction in guanidine salts phenol extractions at pH 5-6 (pH 8 for DNA) selective precipitation of high MW forms (rRNA, mRNA) with LiCl oligo-dT column for mRNA’s treatment with RNase-free DNase Guanidine salts – very fast destruction of cells and strong denaturation including RNases – speed of the first step in RNA isolation is very important due to the presence of RNases in environment. Use Lithium Chloride (0.8M final conc) for RNA. This is because 2.5-3 volumes of ethanol should be used for RNA precipitation and LiCl is more soluble in ethanol than NaAc so will not precipitate, but beware - chloride ions will inhibit protein synthesis and DNA polymerase so LiCl is no good for RNA preps for in vitro translation or reverse transcription. In these cases, use NaAc.

Using UV spectroscopy to analyze DNA/ RNA MOLECULAR BIOLOGY – Molecular biology techniques Using UV spectroscopy to analyze DNA/ RNA Nucleic acids absorbs UV light with a major peak at 260nm (max) Absorbance Wave Length () 260 Beer-Lambert equation A = cl Absorbance extinction coefficients () vary depending on the nucleic acid structure A260 Isolated nucleotides ss RNA/ DNA  = 25 ds DNA  = 20 A260 / A280 ratio indicates sample purity Pure RNA = 2.0 Pure DNA = 1.8 Detection Quantitation Assessment of purity

MOLECULAR BIOLOGY – Molecular biology techniques So now we have isolated DNA ... but it is still too long to work with: 2 how to fragment it? - mechanical shearing (no control) or ...

Ability to join two foreign pieces of DNA together MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR SCISSORS - TYPE II RESTRICTION ENDONUCLEASES Hamilton Othanel Smith 1968 cohesive ends SPECIFIC CUT SPECIFIC JOINING (LIGATION) Ability to join two foreign pieces of DNA together

MOLECULAR BIOLOGY – Molecular biology techniques BLUNT END COHESIVE ENDS

MOLECULAR BIOLOGY – Molecular biology techniques RECOMBINANT DNA TECHNOLGY 3 The plasmid as DNA ‘vector’ (vehicle) Possible to insert ‘interesting’ DNA’s into a plasmid using restriction endonucleases

MOLECULAR BIOLOGY – Molecular biology techniques RECOMBINANT DNA TECHNOLGY The plasmid as DNA ‘vector’ (vehicle) The recombinant plasmid containing the ‘interesting’ DNA sequence can now be propagated/ amplified by experimentally transforming the recombinant plasmid into bacteria and allowing these bacteria to multiply and produce more recombinant plasmid Specialized strains of bacteria can be permeablised by electroporation of heat shock Therefore specific DNA fragments can be selectively propagated i.e. cloned

MOLECULAR BIOLOGY – Molecular biology techniques RECOMBINANT DNA TECHNOLGY Specialized plasmid cloning vectors Muliple Cloning Site (MCS) contains many restriction sites to maximize target DNA cloning potential Plasmids contain genes that confer antibiotic resistance so that only successfully transformed bacteria are propagated

i.e. together they represent a ‘Genomic DNA Library’ MOLECULAR BIOLOGY – Molecular biology techniques 3 Why not clone whole genomes? i.e. together they represent a ‘Genomic DNA Library’ Each bacterial colony represents an amplified clone containing a recombinant plasmid harbouring a distinct region of the genome Characteristics of an "Ideal" cloning vector in bacteral systems. (a) DNA must be replicated by host cell, and successfully "partitioned" into the daughter cells. (b) Must confer recognizable phenotype upon the recipient cell. (R-plasmids are especially useful, because their drug resistance markers provide selective advantage for the host). (c) Must have specific sites for specific restriction endonuclease recognition sequences. (single sites are optimal, that way you can open up the circle once and slip your desired DNA fragment inside). (d) It is desirable that the vector can be easily transferred into recipient by one of the previously mentioned methods of gene transfer. Also possible to do this using cDNA copies of transcribed mRNAs resulting a ‘cDNA Gene Expression Library’

MOLECULAR BIOLOGY – Molecular biology techniques Bacteriophage Lambda vectors  phage linear DNA genome cos cos Non-essential region allowing that can be substituted by DNA to be cloned (approx 20Kb) Cosmids, phosmids, BACs and YACs to clone larger DNA fragments

MOLECULAR BIOLOGY – Molecular biology techniques AMPLIFICATION DNA ISOLATION 4 How to visualize DNA? GEL ELECTROPHORESIS NUCLEIC ACID HYBRIDIZATION size distinction sequence distinction

MOLECULAR BIOLOGY – Molecular biology techniques GEL ELECTROPHORESIS fragmented DNA - - - + agarose D-galactose 3,6-anhydro L-galactose n

MOLECULAR BIOLOGY – Molecular biology techniques Ethidium Bromide SYBR® Safe on blue light

MOLECULAR BIOLOGY – Molecular biology techniques Genomic DNA on gel: 23 kb 9,5 kb

MOLECULAR BIOLOGY – Molecular biology techniques Plasmid DNA on gel: uncut plasmid DNA has several distinct conformations which can be identified when the uncut plasmid is electrophoresed in an agarose gel. Supercoiled DNA (Form I), is the fastest conformation of the uncut plasmid. The enzyme DNA gyrase introduces these extra twists into chromosomal and plasmid DNA of bacteria. The bacteria use the superhelical tension to assist in processes like replication and transcription. After isolating the supercoiled (sc) plasmid DNA, it is wound up into a compact structure. Imagine taking a circle of string and rolling it around in your hands until it forms a little ball. Because of its compact shape, sc DNA is the fastest moving comformation in the gel. Nicked Circle DNA (Form II) is also called relaxed circle. In bacteria, the enzyme topoisomerase I will nick one strand of the helix so that DNA polymerase has access to the DNA for replication. Once one of the strands has been cut, the superhelical tension relaxes and the tightly-wound ball becomes a floppy circle. A nick can also occur during isolation of the plasmid because of enzyme activity or mechanical shearing of the DNA.  Nicked circle (nc) is the slowest conformation of uncut DNA. Linear DNA (Form III) is produced when a restriction enzyme cuts a plasmid at only one site. Both strands of the helix are cut at the same place. Linear DNA can occur because of endonuclease contamination of the isolated plasmid, or because of harsh treatment. On a gel the linear DNA will run between the sc and nc conformations, often closer to the sc band. These are the three main conformations of single plasmid molecules, or monomers. However, under certain conditions, two plasmid molecules can join to form a dimer. Since the dimer form is twice as large as the monomer, it will run higher in the gel. It is possible to have sc, nc, and linear forms of the dimer. As with the monomeric plasmid, the sc will be the fastest conformation and the nc will be the slowest. It is also possible for more than two plasmid molecules to join and create high molecular weight multimers. It is usually difficult to distinguish conformations of multimers.

NUCLEIC ACID HYBRIDIZATION MOLECULAR BIOLOGY – Molecular biology techniques NUCLEIC ACID HYBRIDIZATION labeled probe Fluorescence In Situ Hybridization (FISH) Metaphase spread chromosomes on a slide

MOLECULAR BIOLOGY – Molecular biology techniques Probe labeling by incorporation of modified (d)NTPs 32P radioactive labeling AUTORADIOGRAPHY Fluorophores conjugation Enzymes alkaline phosphatase horseradish peroxidase Biotin-11-dUTP Streptavidin Streptavidin is a 53,000 dalton[1] tetrameric protein purified from the bacterium Streptomyces avidinii. It finds wide use in molecular biology through its extraordinarily strong affinity for the vitamin biotin; the dissociation constant (Kd) of the biotin-streptavidin complex is on the order of ~10-15 mol/L, ranking among one of the strongest known non-covalent interactions. Y anti-DIG antibody (DIG) chemiluminiscence

MOLECULAR BIOLOGY – Molecular biology techniques DIG substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP

MOLECULAR BIOLOGY – Molecular biology techniques DNA denaturation Melting (denaturation) temperature depends on these major factors: - GC content (and therefore AT content) - sequence length - gaps in the annealed strands - salt concentration - pH - organic solvents (DMSO, formamide...) GC rich AT rich Temp

MOLECULAR BIOLOGY – Molecular biology techniques

CHROMOSOME PAINTING – MULTI COLOR FISH MOLECULAR BIOLOGY – Molecular biology techniques CHROMOSOME PAINTING – MULTI COLOR FISH Translocated chromsome segment Particularly useful when diagnosing chromsomal abnormalities in certain forms of cancer (region specific barcoding on left and whole chromsosome paints on right)

MOLECULAR BIOLOGY – Molecular biology techniques Where in organism is the gene expressed? Detection of mRNA by in situ hybridization: Adaptation of DNA FISH protocol (removal of genomic DNA by predigestion with DNase and use of labeled RNA probes to detect expressed transcripts)

MOLECULAR BIOLOGY – Molecular biology techniques How to analyze specific form of genes in genomic DNA? e.g. successful intergration of a transgene into the genome of a transgeneic animal (mouse)

e.g. fragmentation by restriction endonucleases MOLECULAR BIOLOGY – Molecular biology techniques Southern blot – transfer of DNA to membrane e.g. fragmentation by restriction endonucleases fragmented DNA Figure 8-38 (part 1 of 4) Molecular Biology of the Cell (© Garland Science 2008)

MOLECULAR BIOLOGY – Molecular biology techniques Figure 8-38 (part 2 of 4) Molecular Biology of the Cell (© Garland Science 2008)

MOLECULAR BIOLOGY – Molecular biology techniques Labeled probe has sequence homology to DNA of interest e.g. the hopefully integrated transgene Figure 8-38 (part 3 of 4) Molecular Biology of the Cell (© Garland Science 2008)

MOLECULAR BIOLOGY – Molecular biology techniques e.g. bands reveal integrated transgenes and size shows whether integration was correct Figure 8-38 (part 4 of 4) Molecular Biology of the Cell (© Garland Science 2008)

MOLECULAR BIOLOGY – Molecular biology techniques SOUTHERN BLOT combines DNA fragmentation, gel electrophoresis and hybridization to analyze specific DNA sequences Same procedure blotting RNA used to confirm gene mRNA expression called NORTHERN BLOTTING Similar principle used to blot proteins that are then detected by specific antibodies - WESTERN BLOTTING Figure 8-38 Molecular Biology of the Cell (© Garland Science 2008)

SINGLE NUCLEOTIDE POLYMORPHISM (SNP) MOLECULAR BIOLOGY – Molecular biology techniques SINGLE NUCLEOTIDE POLYMORPHISM (SNP)

Restriction Fragment Length Polymorphism (RFLP) MOLECULAR BIOLOGY – Molecular biology techniques Restriction Fragment Length Polymorphism (RFLP) EcoRI 3’AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATTCTGCGATGTT’5 5’TCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAA’3 3’AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT’5 5’TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA’3 SNP Restriction digestion by EcoRI 3’AGCTAGCGTGCTGTGATGTAGCTGATGCTG AATTCTGCGATGTT’5 5’TCGATCGCACGACACTACATCGACTACGACTTAA GACGCTACAA’3 3’AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT’5 5’TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA’3

MOLECULAR BIOLOGY – Molecular biology techniques RFLP RFLP: - loss or gain of restriction site produces different sized DNA fragments on Southern blot - also sensitive to insertion and deletion events - polymorphisms do not have to be associated with the genetic locus of the probe - application depends on enzymes and probes

MOLECULAR BIOLOGY – Molecular biology techniques Diagnosis of Genetic Diseases by RFLP

MOLECULAR BIOLOGY – Molecular biology techniques GENOMIC or cDNA EXPRESSION LIBRARY Hybridization to filter complementary isolate DNA cloning

MOLECULAR BIOLOGY – Molecular biology techniques genomic library hybridisation . experimentation sub-clone restriction digestion

MOLECULAR BIOLOGY – Molecular biology techniques How to see genes ... How to see specific forms of genes? How to clone and amplify genes? ... where in tissues? ... where on chromosomes? in situ hybridization southern blot recombinant DNA genomic libraries RFLP

MOLECULAR BIOLOGY – Molecular biology techniques Table 8-3 Molecular Biology of the Cell (© Garland Science 2008)