Human Genetic Mutations

Slides:



Advertisements
Similar presentations
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)
Advertisements

Human Genetic Mutations
Mutation and Genetic Change
Human Genetic Mutations
DNA MUTATIONS.
Mutations. What Are Mutations?  Changes in the nucleotide sequence of DNA  May occur in somatic cells (aren’t passed to offspring)  May occur in gametes.
Competency 5 Cloning DNA Fingerprinting Karyotypes Genetics Pedigrees Mutations.
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
Human Genetic Mutations
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
MUTATIONS.
Mutations Genetic Changes.
Changes in DNA that affect genetic information
Don’t let this happen to you!!. MUTATIONS Changes in DNA that affect genetic information.
 Mutations are a result in a change in DNA sequence › A protein with a different AA sequence could be produced. › Germ Cell - If mutations occur in sex.
Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.
Human Genetic Mutations
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.
Don’t let this happen to you!!
Changes in DNA that affect genetic information
May occur in somatic cells (aren‘t passed to offspring)
Human Genetic Mutations
Mutations SBI3U Ms. Lefebvre
Section 1: Mutation and Genetic Change
Mutations.
Chapter 14 GENETIC VARIATION.
DNA MUTATIONS.
A change in the DNA sequence that affects genetic information
Mutations.
Mutations.
Mutations.
Mutations.
Mutations.
Genetic Mutations.
Changes in DNA that affect genetic information
Changes in DNA that affect genetic information
Copy 120 RNA gizmo 121. Sickle Cell Mutation notes
Human Genetic Mutations
Human Genetic Mutations
A change in the DNA sequence that affects genetic information
Mutations 5.4.
Don’t let this happen to you!!
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
Mutations Section 12-4.
Mutations.
Section 1: Mutation and Genetic Change
MUTATIONS.
Turner College & Career High School  2016
Mutations.
Changes to the Genetic Code
Mutations.
Human Genetic Mutations
Mutations.
Mutations Ms MacCormack Fall 2018.
Bellwork How do we account for the wide variety of organisms that are on the Earth?
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations 1.
Mutations Good intro video
Human Genetic Mutations
Copyright Pearson Prentice Hall
Don’t let this happen to you!!
Mutations.
Mutations.
Presentation transcript:

Human Genetic Mutations

Mutations Mutations are a result of a change in the DNA sequence A different protein or a dysfunctional protein may be produced If mutations occur in sex cells they may be passed on to the next generation. A mutation occurring in somatic cells may be a problem for the individual but will not be passed on to the offspring.

Chromosomal Alterations Mutations Mutations may be classified as Chromosomal Alterations or Gene Mutations Chromosomal alterations are generally more severe because many genes are usually involved.

Chromosomal Mutations Any change in the structure or number of chromosomes Large scale -Affects many genes

Gene Mutations Small scale: one gene is affected Any change to the DNA sequence of a gene Nucleotides/Bases may be added, missing, or changed

Significance of Mutations Most are neutral Eye color Birth marks Some are harmful Cystic Fibrosis Down Syndrome Some are beneficial Sickle Cell Anemia to Malaria Immunity to HIV

What Causes Mutations? There are two ways in which DNA can become mutated: Mutations can be inherited. Parent to child Mutations can be acquired. Environmental damage Mistakes when DNA is copied

5 Types of DNA alteration Deletion Duplication Inversion Translocation Non-Disjunction

One or more genes are removed Chromosomal Deletion One or more genes are removed Example: Wolf-Hirschhorn syndrome (severe mental retardation) Cri du chat syndrome (mewing sounds, mental retardation)

Chromosomal Duplication A segment of genes is copied twice and added to the chromosome Example: Charcot–Marie–Tooth disease (high arched foot, claw feet, confined to a wheelchair)

Chromosomal Inversion a segment of genes flip end-to-end on the chromosome Example: Four-Ring Syndrome (cleft pallate, club feet, testes don’t descend)

Chromosomal Translocation Material is swapped with another chromosome Example: Burkitt’s Lymphoma (cancer of the lymph nodes, in children)

Nondisjunction Chromosomes FAIL TO SEPARATE during meiosis Meiosis I Nondisjunction Meiosis II Nondisjunction

Nondisjunction Produces gametes (and therefore a baby) with one missing chromosome or one extra chromosome

Too much or too little DNA is bad! KEY POINT #1 Too much or too little DNA is bad!

Gene Mutations: 2 Types Point Mutation Frameshift Mutation

Point mutation Only one nucleotide changes, but it makes a different protein

Point Mutation One base (A, T, C, or G) is substituted for another 3 Possible Consequences: nonsense mutations: code for a stop, which can translate the protein missense mutations: code for a different amino acid silent mutations: code for the same amino acid

Gene Mutations Point Mutations – changes in one or a few nucleotides Substitution THE FAT CAT ATE THE RAT THE FAT HAT ATE THE RAT Insertion THE FAT CAT XLW ATE THE RAT Deletion THE FAT ATE THE RAT

Frameshift Mutation One or more bases (A, T, C, or G) are added or deleted Caused by: Insertion: adding a base Deletion: removing a base

Frameshift Causes every codon in the DNA sequence to be changed after the mutation: Insertion- one or more bases are added Deletion- one or more bases are removed A

Causes of Mutations spontaneous occur during DNA replication Caused by MUTAGENS physical, ex: radiation from UV rays, X-rays or extreme heat or chemical (molecules that misplace base pairs or disrupt the helical shape of DNA).

Gene Mutations KEY IDEA: A mutated gene will make a mutated protein Mutant proteins are trouble! They do not go where they are supposed to go They do not do what they are supposed to do

KEY POINT #2 Mutation of a gene = Mutant protein Dysfunctional proteins cause the symptoms of the disorder

Length of Telomeres telomeres Telomeres are structures at the ends of chromosomes that shorten with each cell division. After 50 divisions, the shortened length of telomeres causes mitosis to stop.