“Structure Based Drug Design for Antidiabetics”

Slides:

Advertisements

Similar presentations

Combinatorial computational method gives new picomolar ligands for a known enzyme Bartosz A. Grzybowski, Alexey V. Ishchenko, Chu- Young Kim, George Topalov,

Advertisements

The post-genomic challenge Exploring function across protein families using chemical probes  The CPFM is in early stages of development  Projects focus.

Knowing When to Give Up Sensible Evaluation in Virtual Screening for Drug Discovery Gwyn Skone Stephen Cameron and Irina Voiculescu.

AutoDock 4 and AutoDock Vina -Brief Intruction

In silico small molecule discovery Sales Target gene Discover hit Hit to lead Optimise lead Clinical Target gene identified with a viable assay High throughput.

Jürgen Sühnel Institute of Molecular Biotechnology, Jena Centre for Bioinformatics Jena / Germany Supplementary Material:

Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.

Summary Molecular surfaces QM properties presented on surface Compound screening Pattern matching on surfaces Martin Swain Critical features Dave Whitley.

Design of Small Molecule Drugs Targeted to RNA RNA Ontology Group May

OMICS Group Contact us at: OMICS Group International through its Open Access Initiative is committed to make genuine and.

In Silico Design of Selective Estrogen Receptor Modulators from Triazoles and Imines Joey Salisbury Dr. John C. Williams Small Molecules/Large Molecules.

Protein Structure and Drug Discovery Workshop To be held at Monash University, Mebourne, Australia October 3 rd to 4 th 2006 Molecular Visualization Learn.

Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.

OMICS Group Contact us at: OMICS Group International through its Open Access Initiative is committed to make genuine and.

Structure Based Drug Design

Important Points in Drug Design based on Bioinformatics Tools History of Drug/Vaccine development –Plants or Natural Product Plant and Natural products.

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG

Bioinformatics for biomedicine Protein domains and 3D structure Lecture 4, Per Kraulis

Computational Techniques in Support of Drug Discovery October 2, 2002 Jeffrey Wolbach, Ph. D.

Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.

PHARMACEUTICAL CHEMISTRY RESEARCH PROJECTS 2013 ;.

Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.

Computational Analyses of Human Kinome against EGFR-TKIs using Homology Modeling and Molecular Docking Approaches Orathai Sawatdichaikul Institute of Food.

Rational Drug Design Soma Mandal, Mee'nal Moudgil, Sanat K. Mandal.

EXPLORING CHEMICAL SPACE FOR DRUG DISCOVERY Daniel Svozil Laboratory of Informatics and Chemistry.

Daniel Brown. D9.1 Discuss the use of a compound library in drug design. Traditionally, a large collection of related compounds are synthesized individually.

Different methods for structure elucidation. Spectroscopy: Studying the properties of matter through its interaction with different frequency components.

PHC 222 Medicinal Chemistry-1- Part(I) Dr. Huda Al Salem Lecture (1)

Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.

1 © Patrick An Introduction to Medicinal Chemistry 3/e Chapter 9 DRUG DISCOVERY: FINDING A LEAD Part 4: (Lead compounds - Impact of the human genome project)

Interesting Developments. Historic trends in biotech fields.

In silico discovery of inhibitors using structure-based approaches Jasmita Gill Structural and Computational Biology Group, ICGEB, New Delhi Nov 2005.

Page 1 SCAI Dr. Marc Zimmermann Department of Bioinformatics Fraunhofer Institute for Algorithms and Scientific Computing (SCAI) Grid-enabled drug discovery.

CZ3253: Computer Aided Drug design Lecture 1: Drugs and Drug Development Part I Prof. Chen Yu Zong Tel:

1 © Patrick An Introduction to Medicinal Chemistry 3/e Chapter 9 DRUG DISCOVERY: FINDING A LEAD Part 2: Section 9.4 (Lead compounds from the natural world)

Physicochemical Properties of Drugs in relation to Drug Action Roselyn Aperocho Naranjo, RPh, MPH USPF, College of Pharmacy

Rational Drug Design Dr Robert Sbaglia. Curriculum Vitae Bachelor of Science (Honours), University of Melbourne Bachelor of Science.

Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:

In memory of Rich Green An Outstanding Medicinal Chemist and Colleague.

Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.

GRIDP: Web-enabled Drug Discovery Is there any way I can use computational tools to reduce the number of molecules I have to screen to a manageable number,

1 © 2. DRUG TARGETS Between species Antibacterial and antiviral agentsAntibacterial and antiviral agents Identify targets which are unique to the invading.

Computational Approach for Combinatorial Library Design Journal club-1 Sushil Kumar Singh IBAB, Bangalore.

Docking and Virtual Screening Using the BMI cluster

Bioinformatics and drug development and diagnostics.

Molecular Modeling in Drug Discovery: an Overview

Natural products from plants

Page 1 Computer-aided Drug Design —Profacgen. Page 2 The most fundamental goal in the drug design process is to determine whether a given compound will.

Dr. George Geromichalos, Ph.D.

Computational Chemistry

APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY

Important Points in Drug Design based on Bioinformatics Tools

Discovery and Development of Medicines

סמים וסינפסות.

Proteon Scientists from Creative Biolabs are willing to provide custom antibody affinity measurement using ProteOn system. The system is a surface plasmon.

Drug Affinity Responsive Target Stability (DARTS).

Molecular Docking Profacgen. The interactions between proteins and other molecules play important roles in various biological processes, including gene.

Bioinformatics in Drug Design

Discovery of Molecular Oxidation Catalysts Using Metallo-Enzyme Mimicry and Combinatorial Chemistry Stephen B. Colbran & D. Brynn Hibbert, School of Chemistry,

Bindings of oliver leaf extract (OLE) to HIV-1 fusion protein gp41 John Z.H. Zhang, Department of Chemistry, New York University Recent experimental study.

Structure-based drug design: progress, results and challenges

Reporter: Yu Lun Kuo (D )

Important Points in Drug Design based on Bioinformatics Tools

ORGANIC PHARMACEUTICAL CHEMISTRY IV

Antibacterial Drug Discovery (ADD) at Leeds

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Julia Salas Case Study, CS379a

Presentation transcript:

“Structure Based Drug Design for Antidiabetics” PTPN1 in PDB view

Steps for structure or Structure Based Drug Design, in brief Structure of target protein receptor Preparation of a computational model for in-silico analysis Docking and analysis database Ligand Ligand optimization Lead molecule Hindu College of Pharmacy, Guntur A.P 1/31/2015

BURGER’S “MEDICINAL CHEMISTRY AND DRUG DISCOVERY”, JHON WILEY AND SONS PUBLICATION, LONDON,SIXTH EDITION, 2009 Hindu College of Pharmacy, Guntur A.P 1/31/2015

Structure Based Drug Design Compound databases, Microbial broths, Plants extracts, Combinatorial Libraries Target Enzyme (or) Receptor Random screening synthesis 3D structure by Crystallography, NMR, electron microscopy (or) Homology Modeling Lead molecule Receptor-Ligand Complex Testing Redesign to improve affinity, specificity etc. Docking Linking or Binding 3D QSAR 3D ligand Databases BURGER’S “MEDICINAL CHEMISTRY AND DRUG DISCOVERY”, JHON WILEY AND SONS PUBLICATION, LONDON,SIXTH EDITION, 2009 Hindu College of Pharmacy, Guntur A.P 1/31/2015

How to design a drug by using SBDD – an example 1. Obtain target protein 2. Preparation of protein 3. Identification of receptor pocket 4. Preparation of compound database 5. Docking 6. Analysis 7. Ligand optimization 8. Re-evaluation 9. Identification of lead molecule Hindu College of Pharmacy, Guntur A.P 1/31/2015

Thank you Hindu College of Pharmacy, Guntur A.P 1/31/2015