Gene Location and Pedigrees We refer to genes as either sex-linked (on the sex-determining chromosomes) or autosomal (not on the sex-linked chromosomes)

Sex Linkage Sex-linked traits: traits that are controlled by genes located on the sex chromosomes ex. X-linked recessive: red-green colourblindness in humans: a recessive allele located on the X gene More prevalent in males since females would have to inherit 2 recessive alleles to be red-green colourblind Since males inherit only one X chromosome they require only one recessive allele to be colourblind

Ex. X-linked dominant

Why use Pedigrees? Punnett squares work well for organisms that have large numbers of offspring and controlled matings, but humans are quite different: 1. Small families - Even large human families have 20 or fewer children. 2. Uncontrolled matings, often with heterozygotes.

Goals of Pedigree Analysis 1. Determine the mode of inheritance: dominant, recessive, sex-linked, autosomal, mitochondrial. 2. Determine the probability of an affected offspring for a given cross.

Basic Symbols

More Symbols Fraternal Twins Identical Twins

Try and figure out the method of inheritance… X-linked recessive

Try and figure out the method of inheritance… Autosomal recessive

Try and figure out the method of inheritance… X-linked recessive

Pedigrees and Sickle-cell Anemia

Case Study: Sickle Cell Anemia One of the most common genetic diseases that afflicts persons of African ancestry. about 10% of such persons carry the allele for this trait in some areas of Africa, upwards of 40% carry the allele Homozygous individuals with sickle-cell disease suffer from: “Crises” in joints and bones Strokes, blindness Damage to lungs, kidneys or heart

Untreated, many sufferers die before the age of 20 Modern medical treatments can prolong life to age 40-50 (for individuals who are homozygous for Sickle cell anemia) Normal allele (A) and Sickle allele (S) are CODOMINANT In heterozygous individuals (AS), both normal and abnormal hemoglobin are produced Individuals are usually healthy, but may notice problem in conditions of low oxygen (high altitude) Known as ‘carriers’

Sickle Cell Disease What does it actually do? Affects the structure of hemoglobin Help bind oxygen in blood, carry to body cells Hemoglobin becomes ‘sticky’, and red blood cells collapse when there is no oxygen Slide 4.1 -Make sure the students understand the following points. Red blood cells become banana shaped when oxygen is low in the blood. The oddly shaped cells cause blockages. The blockages cause pain, damage to tissue and organs, even death. Normal red blood cells Sickled red blood cells

Hemoglobin Hemoglobin subunit Red Blood Cell Oxygen molecule Tell students hemoglobin is a protein in red blood cells. FUNCTION? four subunits. Each subunit is a single chain of amino acids Carrying oxygen is a four protein job. Each individual protein chain is called a subunit. Oxygen molecule

Sickle cell traits - malaria

Mutation found in Hemoglobin Sequence of normal hemoglobin DNA: CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA Amino acids: Sequence found in sickling hemoglobin DNA: CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA

Mutation found in Hemoglobin Sequence of normal hemoglobin DNA: CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA Amino acids: L T P E E K S Sequence found in sickling hemoglobin DNA: CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA Amino acids: L T P V E K S Hemoglobin forms long chains inside red blood cells. hydrophobic parts of proteins like to clump together (like hydrophobic amino acids). can interact with other nearby sickle cell hemoglobins when no oxygen is present forming long crystals of hemoglobin inside of the red blood cells. In contrast normal hemoglobin proteins stay separated when no oxygen is present. The long chains in of sickle cell hemoglobin stretch the red blood cell so that it looks banana shaped.

Sickle Cell Hemoglobins Stick Together Normal hemoglobin Sickle Cell hemoglobin No Oxygen No oxygen Slide 4.5 and 4.6 - Explain that scientists have explored this mutation and its affect on hemoglobin and have determined there is a problem. Hemoglobin forms long chains inside red blood cells. Then show cartoon images showing this. Explain to students that the hydrophobic parts of proteins like to clump together (like hydrophobic amino acids). In this case the abnormal hydrophobic patch on the outside of the protein, can interact with other nearby sickle cell hemoglobins when no oxygen is present forming long crystals of hemoglobin inside of the red blood cells. In contrast normal hemoglobin proteins stay separated when no oxygen is present. The long chains in of sickle cell hemoglobin stretch the red blood cell so that it looks banana shaped. No Oxygen: Separate No Oxygen: stuck together

Effects of Sickle Cell Mutation CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA DNA order of amino acids L T P E E K S L T P V E K S protein shape Slide 4.7 - Students struggle to make connections from genes to traits so use this slide to walk through the steps from gene to protein to trait. cell function

Case Study: Sickle Cell Anemia Why do we see this more often in Africa, especially when it is deadly? There must be a benefit to having this abnormal allele! Malaria! Caused by a blood parasite Infect red blood cells When a blood cell with defective hemoglobin are infected, the cells sickle and die The parasite is trapped and infection is reduced