Low rates of voriconazole resistance and absence of CYP51A mutations among A. fumgiatus recovered from lung transplant recipients receiving prophylaxis M. Hong Nguyen, Don X Nguyen, Shaoji Cheng, Cornelius J Clancy, Department of Medicine, University of Pittsburgh INTRODUCTION RESULTS We previously showed that voriconazole (VOR) prophylaxis for 3-6 months after lung transplant (LTx) reduced but did not eliminate fungal infection. Breakthrough (BT) infection was predominantly due to Aspergillus spp. other than A. fumigatus and other moulds. Infections off Px were predominantly due to A. fumigatus. Azole-resistant Af with cyp51A mutations have emerged in Europe, Asia and the Middle East, largely due to agricultural fungicide use. Figure 1. Aspergillus spp. recovered from lung transplant recipients Figure 2. Association between Aspergillus spp. recovered from patients and azole breakthough status cyp51A mutations Eighteen of 21 A. fumigatus were determined for cyp51A mutations: Itraconazole: 61% (11) susceptible, 28% (5) S-DD, 11% (2) resistant Posaconazole: 83% (15) susceptible, 11% (2) S-DD, 6% (1) resistant Voriconazole: 83% (15) susceptible, 16% (3) S-DD 3 isolates harbored a 795 A>G mutation None of the azole-resistant isolates carried the 795A>G mutation. OBJECTIVES The objectives of this study were to: Define the epidemiology of azole-resistance among lung transplant recipients who had received voriconazole prophylaxis Identify potential cyp51A mutations in resistant Aspergillus fumigatus isolates Figure 3. Distribution of azole MICs for all Aspergillus isolates Figure 6. Association between any azole resistant A. fumigatus isolate and cyp51A 795A>G METHODS From 2009 to 2013, we collected Aspergillus isolates from lung transplant recipients and stored them at -80˚C Speciation of Aspergillus was performed by the microbiology laboratory using both macroscopic and microscopic characteristics on Sabouraud dextrose agar (SDA) medium The isolates were subcultured on SDA twice prior to antifungal susceptibility testing (AFST) against voriconazole, itraconazole, and posaconazole AFST was performed using the microbroth dilution method referenced in the CLSI document M27-A3 Resistant isolates were defined as follows: susceptible: ≤0.25 μg/mL S-DD: 0.5-1 μg/mL resistant: ≥ 2 μg/mL After PCR amplification, the full sequence of the cyp51A gene and its promoter region was determined for all isolates. Primers used: AfCyp51A-F (5’-AGTTGTCTAGAATCACGCGGT -3’) AfCyp51A-R (5’- CAGCTCGTTGGAATACATTCA -3’) AfCyp51A-Seq (5’- AGCTCAAGGATGTCAATG -3’) The obtained cyp51A sequences were compared with the cyp51A sequence available through GenBank (accession #AF338659). CONCLUSIONS Routine voriconazole prophylaxis post-lung transplant was not associated with the emergence of voriconazole-resistant Aspergillus Taken with previous data, sub-therapeutic serum voriconazole concentrations rather than resistance are responsible for breakthrough infections due to Aspergillus spp. Systematic therapeutic drug monitoring and interventions to optimize voriconazole pharmacokinetics should improve prophylaxis efficacy In contrast to voriconazole, itraconazole and posaconazole resistance rates were significant. Target mutations may exert differential effects on Aspergillus susceptibility to itraconazole and posaconazole, compared to voriconazole cyp51A mutations do not appear to mediate resistance in A. fumigatus isolates from this patient population, but the sample size of azole-resistant A. fumigatus tested in this study was small Figure 4. Azoles MIC stratified by Aspergillus spp. Figure 5. MICs of breakthrough versus non-breakthrough Aspergillus isolates. Itraconazole Posaconazole Voriconazole REFERENCES Schaenman JM (2013). Is universal antifungal prophylaxis mandatory in lung transplant patients? Curr Opin Infect Dis. 26:317-325. Denning D, Park S, Lass-Florl C, et al. (2011). High-frequency triazole resistance found in nonculturable Aspergillus fumigatus from lungs of patients with chronic fungal disease. Clin Infect Dis. 52:1123-1129. Mitsani D, Nguyen MH, Shields RK, et al (2012). Prospective, observational study of voriconazole therapeutic drug monitoring among lung transplant recipients receiving prophylaxis: factors impacting levels of and associations between serum troughs, efficacy, and toxicity. Antimicrob Agents Chemother. 56:2371-7. ACKNOWLEDGMENTS This project was partially funded by the University of Pittsburgh Dean’s Summer Research Program (DXN), and XDR Pathogen Lab at the University of Pittsburgh Medical Center (MHN). DXN and MHN are not related. Note: MICs of itraconazole and posaconazole are lower for A. fumigatus isolates than non-A. fumigatus isolates (p=0.04 for itraconazole and p=0.05 for posaconazole) Note: There are no differences in MICs between breakthrough and non-breakthrough infections for itraconazole (p=0.4), posaconazole (p=0.85), or voriconazole (p=0.58)