DNA – Deoxyribonucleic acid Biology ATAR DNA – Deoxyribonucleic acid

Deoxyribonucleic acid Mitochondrial DNA Double helix Nucleic acid Phospate molecule Dioxyribose sugar Nucleotide base Base pairs Adenine & Thymine Cytosine & Guanine Chromosomes Genes Protein synthesis DNA replication Leading strand Lagging strand Enzymes DNA polymerase DNA ligase Keywords Keywords

DNA DNA = deoxyribonucleic acid. DNA carries the instructions for making all the structures and materials the body needs to function. DNA is capable of self-replication. Most of the cell’s DNA is found in the nucleus A small amount is contained in the mitochondria. Wellcome Images – Oliver Burston

Structure of the DNA molecule

The structure of the DNA molecule The shape of the molecule is described as a “double helix”. The building blocks of DNA are nucleotides. A nucleotide consists of one phosphate molecule, a five-sided sugar molecule (deoxyribose sugar), and one nucleotide base.

DNA - the double helix Wellcome Images – Peter Artymiuk

The structure of the double helix Wellcome Images - Pete Jeffs

The ladder model The structure of DNA can be understood more easily by untwisting the double helix and displaying the molecule as if it were a ladder. The side rails of the ladder (the “backbone”) are alternating phosphate and sugar (deoxyribose) molecules. The rungs are paired nucleotide base molecules held together by a weak hydrogen bond.

The ‘ladder’ model

The DNA backbone The two side rails of the ladder run in opposite directions These can be identified by the end of the rail which is either a three base (3’) end, or a five base (5’) end. One strand runs from 3’ to 5’ and the opposite strand, from 5’ to 3’.

A nucleotide 3' 5' Nucleotide 5' 3' 5' C O 4' C C 1' 3' C C 2' OH 5' Nitrogen base P 3' G 5' H A T Nucleotide S S Pentose sugar S P P Phosphate 5' T P P H S T A S 3' S P P H C G 5' C S O S 4' C C 1' 3' 5' P 3' C C 2' OH

The base pairing rule Each “rung” of the DNA ladder is formed from two nitrogen bases. There are four bases: adenine (A) thymine (T) cytosine (C) guanine (G) adenine always bonds with thymine (A-T) cytosine always bonds with guanine (C-G).

The base pairs The binding of two nucleotides forms a base pair. cytosine and guanine are bound together by 3 hydrogen bonds adenine and thymine are bound by 2 hydrogen bonds NIH - National Human Genome Research Institute

The base pairs Hydrogen Carbon Nitrogen Oxygen Hydrogen bond Wellcome Images - Pete Jeffs

Location of DNA Most of the DNA occurs in the cell nucleus Some DNA is also found in the mitochondria. Each mitochondrion contains 37 genes This is referred to as mitochondrial DNA (mtDNA) The DNA found in the nucleus is tightly coiled and packaged as chromosomes Only sections of it are uncoiled as needed The only time that all of the chromosomes uncoil is during cell division

Location of DNA

Histones are molecules that help to coil DNA into its chromosome structure

Human cells stained to show the DNA within the nuclei (blue), and the mitochondia in red. Wellcome Images – Paul J Smith & Rachel Errington

The function of DNA

DNA & genes A chromosome consists of segments of DNA known as genes. Each gene contains the building instructions for a specific protein. It is estimated that there are about 20,000– 25,000 genes in the human genome (i.e. about 3 billion base pairs).

Reading the code The sequence of bases is read in groups of three called codons. Thus the sequence: AAGCCGTTTAGAGAGATTCCT Is read as: AAG CCG TTT AGA GAG ATT CCT Each codon represents one of the 20 different amino acids.

Prokaryotes vs. eukaryotes: DNA circular DNA DNA floats loose in the cytoplasm (remember, no membrane-bound organelles present) Small number of genes Eukaryotes Linear DNA (in the form of a double helix) DNA tightly packaged in the nucleus Large number of genes

Eukaryotes: Mitochondrial DNA Mitochondria contain 37 which are responsible for the production of important enzymes involved in cellular respiration. Mitochondrial DNA is passed only from mother to child.

DNA replication

DNA replication DNA is able to produce an exact copy of itself. This process is called DNA replication. DNA replication occurs after cell division (mitosis) when the amount of DNA is halved.

DNA replication Old strand New strand NIH - National Human Genome Research Institute

DNA replication The hydrogen bonds between the nucleotide bases are broken by helicase This ‘unzips’ the double helix, exposing the nucleotide bases Each exposed strand acts as a template for the construction of a new DNA strand. DNA polymerase is the enzyme that works its way along the template strand and adds new nucleotides DNA polymerase works from the 3’ to the 5’ end of the template strand, creating the daughter strand from the 5’ to 3’ end

DNA replication Replication occurs continuously along the leading strand On the lagging strand, the new DNA is made in sections which are later joined together by DNA ligase The fragments of newly made DNA on the lagging strand are called Okazaki fragments

DNA replication

DNA replication - summary By LadyofHats DNA replication https://www.youtube.com/watch?v=27TxKoFU2Nw