Identification of H. pylori genotypes in patients with gastroduodenal diseases in an Egyptian urban community. Fatma A. Amer, Mohamed Elahmady, Azza M. Abdelaziz Microbiology and Immunology Department, faculty of Medicine, Zagazig University, Zagazig and Microbiology department, National liver institute, Menofiya university, Menofiya, Egypt

It is also associated with the development of MALT lymphoma. Helicobacter pylori is an important human pathogen that causes a variety of gastroduodenal diseases such as: chronic gastritis peptic ulcer disease gastric cancer. It is also associated with the development of MALT lymphoma.

The most studied virulence factors are: Several potential virulence factors have been suggested for the pathogenesis of this microorganism. The most studied virulence factors are: the vacuolating cytotoxin (VacA) the cytotoxin-associated antigen (CagA)

vacA gene Induces the formation of pores and anionchannels in epithelial cell membranes with formation of vacuoles. Has also been described as a permease that promotes urea diffusion across epithelia providing an additional source of nutrients to sustain H. pylori growth in vivo. Induce apoptosis in epithelial cells as well as a specific inhibition of immune response.

It comprises three variable parts: vacA gene is present in all H. pylori strains, but it is not similarly expressed in all strains. It comprises three variable parts: the 's' region (encoding the signal peptide) and two alleles, 's1' and 's2'. Several subtypes (s1a, s1b and s1c) can be distinguished. the 'm' region (middle) with two alleles, 'm1' or 'm2'. the intermediate (i) region with two subtypes the i1 and i2. The variations in the three regions cause the differences in vacuolating activities, consequently the variation in disease progression

cagA gene The cagA gene is one of several genes in a pathogenicity island known as cagPAI There is a general consensus that the presence of cagA is a marker for the presence of the cagPAI In comparison with cagPAI-negative strains, infection with cagPAI-positive strains, is assumed to significantly increase the risk of developing severe gastric mucosal inflammation, duodenal ulcer and gastric carcinoma.

Although H. pylori has a worldwide distribution, The prevalence of cagA-positive strains varies in different parts of the world, and there is a clear geographic dissimilarity in the distribution of vacA allelic types

Aim of the study To identify the prevalence of H. pylori cagA and vacA genotypes and the association with gastroduodenal diseases in an Egyptian urban community

Materials and Methods

Patient population: Patients who had received antibiotics, proton-pump inhibitors or NSAIDs, throughout the last 2 months were excluded. Ninety patients who underwent standard gastroscopy procedures at Zagazig University Hospital were the subject of this study. The symptoms reported by these patients were abdominal pain and discomfort, epigastric pain, nausea/vomiting, hematemesis, melena, loss of Appetite , bloating, changes in bowel habits, weight loss .

Patient samples Six gastric biopsy specimens were collected from each patient. Three from the antrum and three from the corpus: Two were inserted into rapid urease test Two were dispatched in formalin for histology Two in 0.9% normal saline for PCR.

Molecular Methods DNA Extraction from biopsy specimens was carried out as reported by Van Zwet , et al. 1993. PCR was performed: first for the identification of H. pylori in gastric biopsy specimens then for the identification of virulence markers. The primers used are shown in table. Glyceraldhyde-3-phosphate dehydrogenase (GAPDH) gene was amplified as internal control. Primers are forward primer 5'-AGCAATGCCTCCTGCACCACCAAC-3' and reverse primer 5'-CCGGAGGGGCCATCCACAGTCT-3'. The size of the amplified GAPDH fragment is 137 bp.

Oligonucleotide primers PCR cycles Primer designation Primer Sequence Size of PCR Product Region Amplified 5 min at 95°C, 1 min at 94°C, 1 min at 45°C, 1 min at 72°C, 5 min at 72°C. HPU1 5'GCCAATGGTAAATTAGTT3' 411bp ureA HPU2 5'CTCCTTAATTGTTTTTAC3' CagA 1 cycle of 94°C for 5 min, 35 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 90 sec, 1 cycle of 72°C for 5 min D008 GGTCAAAATGCGGTCATGG 297-bp C-5' R008 TTAGAATAATCAACAAACATCACGCCAT Vac A alleles 1 cycle of 95°C for 5 min; 35 cycles of 95°C for 1 min, 52°C for 1 min and 72°C for 1 min; 1 cycle of 72°C for 5 min SS1-F GTCAGCATCACACCGCAAC 190-bp S1a VA1-R CTGCTTGAATGCGCCAAAC SS3-F AGCGCCATACCGCAAGAG 187-bp S1b CTGCTTGAATGCGCCAAAC- SS2-F GCTAACACGCCAAATGATCC 199-bp S2

Continue PCR cycles Primer designation m1 290- bp VA4-F 352- bp m2 Primer Sequence Size of PCR Product Region Amplified VA3-F GGTCAAAATGCGGTCATGG m1 VA3-R CCATTGGTACCTGTAGAAAC3' 290- bp VA4-F GGAGCCCCAGGAAACATTG 352- bp m2 VA4-R CATAACTAGCGCCTTGCAC 1 cycle of 95°C for 90 sec; 35 cycles of 95°C for 30 sec, 53°C for 60 sec and 72°C for 30 sec; 1 cycle of 72°C for 5 min Vac-F1 GTTGGGATTGGGGGAATGCCG 426- bp i1 C1R TTAATTTAACGCTGTTTGAAG' i2 C2R GATCAACGCTCTGATTTGA 432- bp Yakoob et al. BMC Gastroenterology 2009 9:87   doi:10.1186/1471-230X-9-87

PRILIMIARY RESULTS

Patient population Fifty-one (56.67%) of patients studied were males and 39 (43.33%) were females. Their ages ranged from 16 to 69 years, the mean age being 40.5 years. 50 (55.56%) patients had gastritis, 15 (16.67%) gastric ulcer, 15 (16.67%) duodenal ulcer and the remaining 10 (11.11%) gastric carcinoma.

Eighty-two (91%) out of the 90 patients studied were found positive for H. pylori. Sixty-five (79%) were positive by the rapid urease test, , 68 (83%) were positive on histologic examination, and all (100%) were positive by PCR.

Virulence marker (% +ve of 69 total) Gastritis (29) No (%) Gastric ulcer (15) No (%) Duodenal ulcer (15) No (%) Gastric carcinoma (10) No (%) Total (69) P cagA (65.2%) 15(51.7%) 10 (66.7%) 11(73.3%) 9(90.0%) 45 0.140 vacAs1 ( 78.3%) 19 (65.5%) 12(80.0%) 13 (86.7%) 10 (100%) 54 0.102 vacAs1a ( 72.5%) 17(58.6%) 12(80%) 9(90%) 50 0.159 vacAs1b (7.2%) 2(6.9%) 1(6.7%) 1(10%) 5 0.988 vacAs2 (21.7%) 10 34.5% 3 20.0% 2 13.3% 15 vacAm1 (53.6%) 5 (17.2%) 12 (80%) 9 (90%) 37 .000 vacAm2 (46.4%) 24(82.8%) 4(26.7%) 3(20%0 32 vacAi1 (52.2%) 3(10.3%) 36 vacAi2 (46.4%) 2586.2% 320.0% 110.0%

Continue 3(10.3%) 11(73.3%) 12(80%) 9(90%) 35 .000 2(6.9%) 9(60%) Virulence marker (% +ve of 69 total) Gastritis (29) No (%) Gastric ulcer (15) No (%) Duodenal ulcer (15) No (%) Gastric carcinoma (10) No (%) Total (69) P vacAs1i1m1(50.7%) 3(10.3%) 11(73.3%) 12(80%) 9(90%) 35 .000 cagAvacAs1/i1/m1(40.6 %) 2(6.9%) 9(60%) 8(80%) 28 vacAs1ai1m1(46.4%) 10(66.7%) 32 cagAvacAs1a/i1/m1(40. 6%) vacAs1bi1m1(4.3%) 1(6.7%) 1(10%) 3 .480 cagA- vacAb/i1/m1(2.9%) 2 .277 vacAs2i2m2 (21.7%) 10(34.5%) 3(20%) 2(13.3%) 15 .102 cagAvacAs2i2m2 (1.4%) 16.7% 1 .301

35 strains: s1/i1/m1 allele, of them 32 were s1a/i1/m1 genotype and 3 were s1b/i1/m1 genotype. 16 strains: s1/i2/m2 gentotype 15 strains: s2/i2/m2 gentotype 1 strain: s1/i2/m1 genotype 1 strain: s1/i1/m2 genotype.  

Conclusions

In our study, the prevalence of cagA-positive strains was comparable to reports from European, North American, and Iranian population. In-spite of the high incidence of cagA-positive strains, no significant association between cagA status and clinical outcome. This goes in accord with studies from Iran, but contrary to studies from Europe and North America. Those from East Asia reported a prevalence of cagA of almost 90% irrespective of the disease.

All possible combinations of VacAs1 with m and i allels were found All possible combinations of VacAs1 with m and i allels were found. s2m1 was not found. No significant associations between vacAs allels or subtypes and diseases outcome. the s1 genotype is found in close association with clinical outcomes in Western countries; however, the prevalence of this genotype was extremely high (almost 100%) in East Asian countries irrespective of clinical outcomes.

Nearly half of the strains (50 Nearly half of the strains (50.72%) of the isolates, encoded the s1/i1/m1 vacA allele, which has been suggested to be the most virulent form. Of them 91.43% were of the s1a subtype.

Associations were seen between disease severity and the vacA m type. This coincides with: a study from Korea which suggested that polymorphism within the m region is the major contributor to disease state within this population. a meta-analysis that found that the m1 region increased the risk for gastric cancer in Latin American (OR=3.59) and African populations.

Associations were seen between disease severity and the vacA i types. Work with Western strains suggested that the i region of vacA is the major determinant of vacuolating activity, and is the most important for disease development. Within population of predominantly East Asian strains, the i region was not a major determinant of disease state.  

Thank You