DNA sequencing © 2016 Paul Billiet ODWS

Frederick Sanger Nobel prize for chemistry 1958 (for his work on proteins) “Dideoxy” technique for DNA sequencing. © 2016 Paul Billiet ODWS

Dideoxyribonucleic acid DNA uses deoxyribose To replicate DNA you need nucleotides with deoxyribose Deoxyribonucleoside triphosphates = dNTPs There are four types (dATP, dCTP, dGTP and dTTP) If a modified sugar is used replication stops Modified sugar = dideoxyribose = ddNTP ddNTPs can be made for each of the bases (ddATP, ddCTP etc). © 2016 Paul Billiet ODWS

Dideoxycytidine triphosphate (ddCTP) © 2016 Paul Billiet ODWS

“Russian Roulette” replication Extract DNA to be sequenced Add supplies of the four dNTPs Split sample in four tubes Add DNA polymerase and one of the ddNTPs Replication will stop after a random number of base pairs at the point where a ddNTP is inserted. © 2016 Paul Billiet ODWS

Gel electrophoresis ddNTP produces a test tube with a mixture of DNA molecules that are different lengths Wherever the ddNTP of that type (A, C, T or G) is inserted They can be separated by gel electrophoresis. © 2016 Paul Billiet ODWS

ELECTROPHORESIS The migration of electrically charged particles in colloidal solution towards the oppositely charged electrode © 2016 Paul Billiet ODWS

Similar to electrolysis CATHODE - + ANODE Solution of NaCl Na+ Cl- CATION ANION © 2016 Paul Billiet ODWS

Gel electrophoresis of proteins and DNA The process of electrophoresis of large molecules such as proteins and nucleic acids is carried out on gels No water currents in gels Correct buffering conditions can be carefully controlled Permits high resolution separation of very small samples. © 2016 Paul Billiet ODWS

DNA DNA is analysed on agarose gels which have big spaces to allow larger molecules of DNA to separate Each nucleotide on the DNA molecule carries a negative charge DNA molecules only move from the negative cathode to the positive anode. © 2016 Paul Billiet ODWS

DNA As the negative charge increases with size, big DNA molecules would move more quickly But bigger molecules move more slowly through the gel Gives a steady and fine separation of DNA molecules by size Molecules which differ by only one nucleotide in their length can be separated. © 2016 Paul Billiet ODWS

Analysis The analysis of the gel by staining, spectroscopy or autoradiography This reveals bands in the gel where the DNA fragments are located Reference molecules are run in the gel at the same time so that the molecules in the mixture can be identified. © 2016 Paul Billiet ODWS

Gel electrophoresis Buffer solution Agarose Gel CATHODE - + ANODE Wells for the mixture DNA fregments separating by size Marker molecule indicates the front © 2016 Paul Billiet ODWS

DNA sequence Run a gel with four columns One from each tube treated with a different type of ddNTP (A, C, T or G) The lengths of the fragments can be compared for each of ddNTPs Read from bottom to top (why?) What is your sequence? © 2016 Paul Billiet ODWS

Answers Bottom is the shortest so the beginning of the sequence TACGAGATATATGGCGTTAATACGATATATTGGAACTT C © 2016 Paul Billiet ODWS

Sequencing today Uses fluorescent dyes not autoradiography One colour for each ddNTP Faster, cheaper, safer Automated Sequencing whole genomes becomes a reality. © 2016 Paul Billiet ODWS

Up to 30 bases per second