Cloning Overview of cloning Plasmid-based vectors Intro to phage lambda Genomic and cDNA libraries

Prior knowledge! Restriction enzymes: cut DNA at specific sequences often leave 5’ or 3’ overhangs (“sticky ends”) DNA ligase: joins DNA strands via 5’ phosphate and 3’ OH Alkaline phosphatase: removes 5’ phosphate from DNA preventing ligation of that strand DNA polymerases: extend a growing DNA strand from the 3’ OH, using a template strand to determine the order of base addition G’GATCC CCTAG.G G CCTAGp pGATCC G pGATCC G G CCTAGp HOGATCC G G CCTAGOH ..GTAGCA ..CATCGTACTAGCTAG..

Overview of cloning strategy plasmid vector Cloning: joining a given piece of DNA to functions that will enable replication of that piece of DNA = replication origin Choice of vector: depends on the DNA to be cloned (size, availability, screening...) + insert bacterial cell host chromosomal DNA clone

Choice of vector depends on purpose of cloning and size of insert Small fragments: 0.1 – 1 kb (1 kb = 1000 bp) small genes for production of protein in E. coli promoters or control elements to study regulation Intermediate fragments: 1 kb – 10 kb larger genes for expression cDNAs (cDNA library?) small operons Larger fragments: 10 – 100 kb genomic fragments for genomic library** genome (organism) reconstruction experiments As well as the size of insert fragment, we must also consider the functions of the vector DNA

For gene expression (and promoter-probing) tend to use plasmid-based vectors Expression of genes: identification of promoter regions; expression of cloned DNA sequences as proteins; gene therapy promoter “reporter” gene $$$ bacterial promoter “useful” gene Which cloning vector do we need?

Protein production

Promoter probing The expression of individual genes is being studied using reporter fusions. When (or where) a gene is expressed is largely determined at the level of its transcription initiation

Promoter probing Spore-specific expression Mycelium-specific expression

Plasmids not vector of choice for cloning gene clusters or making genomic libraries Characterisation of the gene/gene cluster: coding sequences; non-coding/regulatory sequences e Gg Ag d b 50 kb exon 1 exon 2 exon 3 intron 1 intron 2 1.6 kb ORGANISATION OF HUMAN b-LIKE GLOBIN GENE CLUSTER Which cloning vector do we need?

Types of vectors VECTOR - name given to the DNA molecule into which foreign DNA is inserted for subsequent propagation in host cell plasmid bacteriophage lambda bacteriophage M13 cosmid phagemid ESSENTIAL FEATURES OF ALL VECTORS ability to replicate in host cell ability to be readily introduced into host cell ability to readily insert foreign DNA into vector You will be expected to know the properties of all of these vectors

What about the bacterial host? 1. We need efficient transformation by plasmid DNA Use a host deficient in natural restriction modification systems Example: E. coli strain K contains the K restriction-modification system encoded by hsdRMS, so delete the hsdR gene 2. We need stable maintenance of the transformed DNA Avoid rearrangements by using mutants in recombination genes such as recA, recF 3. Disablement of the host for safety reasons Use an auxotroph: host cannot synthesise a metabolite/amino acid; Host can only grow on growth medium supplied in the laboratory Strains carrying recombinant plasmids therefore unlikely to escape and propagate outside laboratory

Plasmid-based vectors Natural plasmids: <1 kb to >100 kb in size From 1 to 1000 copies per cell Replicate independently of chromosome Carry e.g. antibiotic resistance genes Use in cloning: Synthetic plasmids constructed from: - replication origin - selectable marker - cloning site(s)

Engineered plasmids used as cloning vectors ESSENTIAL FEATURES FOR USE AS VECTOR ori (replication) 15-20 copies per cell selectable marker (drug resistance gene) suitable region for insertion of foreign DNA (restriction enzyme sites) suitable size pBR322 4361 bp BamHI PstI EcoRI tet ori amp

pUC19 – a typical plasmid cloning vector 2686 bp amp lacZa mcs ori 2686 bp >500 copies per bacterial cell POLYLINKER (multiple restriction enzyme sites) EcoRI SmaI XbaI PstI HindIII GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT KpnI BamHI SalI

Cloning DNA with plasmid vectors 1. GENERATION OF RECOMBINANT MOLECULE ampr 5’ P P linearise with restriction enzyme (e.g. at site within polylinker) vector DNA 5’ dephosphorylate with calf intestinal phosphatase (prevents vector religation) + T4 DNA ligase P DNA fragment P ligate vector with fragment to be cloned (cDNA, genomic DNA etc; fragment has ends that are “compatible” with ends of cut vector, and is not de-phosphorylated)

+ 2. INTRODUCTION OF RECOMBINANT PLASMID INTO HOST BACTERIA ampr recombinant DNA molecule introduce DNA into host bacteria chemical transformation (treat with CaCl2 to make competent + heat shock) electroporation size limitation for DNA uptake inefficient process bacterial chromosome plasmid + most bacteria do NOT take up plasmid - need selection

3. SELECTION OF BACTERIA CONTAINING PLASMID plasmid replication + bacterial cell division spread on ampicillin plates cells that have not taken up plasmid cannot grow cells that have taken up plasmid (ampr) form colonies

Plasmids – uses and limitations Isolation of DNA Centrifuge liquid culture to collect cell pellet Break open cells Remove protein, degrade RNA Precipitate plasmid DNA (see previous lecture) Yields improved with high copy number plasmids Limitation on transforming host bacteria Chemical (CaCl2) Electroporation (2 – 3 kV) Insert size range 0 – 10 kbp Not really good enough for making a genomic library

Bacteriophage lambda (λ) genomic DNA head tail Efficient injection of λ DNA into the host Can we use this property for a cloning experiment?

Genomic organisation of lambda genome = 49 kb linear double-stranded DNA DNA present in phage particles as linear double-stranded molecule with single-stranded complementary termini of 12 nt (“cohesive ends”) right cohesive end cccgccgctgga 5′ 3′ 3′ 5′ gggcggcgacct left cohesive end (not to scale!)

Properties of the lambda cos site right cohesive end cccgccgctgga gggcggcgacct left cohesive end CIRCULARISATION cos nick

Lambda life cycles LYSIS or LYSOGENY phage particle attaches to E.coli cell and injects its DNA Efficient! lambda DNA cirularises (via cohesive ends) bacterial chromosome LYSIS DNA replication, synthesis of phage products (capsid proteins), particle assembly, cell lysis and phage release or LYSOGENY (integration of  into host genome)  = prophage

What does growth of lambda look like? LIQUID CULTURE ASSAY lysogenisation (sometimes) phage stock bacterial culture bacterial lysis PLAQUE ASSAY low m.o.i. phage stock bacterial culture add aliquot to “top agar” + pour onto agar plate lysis + lysogeny (turbid plaques)

Lambda replication – the lytic pathway cos site circularisation replication via “rolling circle” mechanism catenane “rolled off” the  DNA molecule cos sites ori lambda head and tail proteins synthesised - heads and tails assembled separately

Packaging of lambda in vivo 1. Packaging of concatenate into prehead concatenate is cleaved at cos site during packaging into prehead (phage encoded endonuclease) fixed length is always packaged (packaging constraint) 2. Filled heads associate with preformed tails + mature lambda particle

Supplement – Methods of Selection How to distinguish an “empty” vector (i.e. no insert present) from a recombinant molecule (containing a cloned insert)? Differential antibiotic resistance Possible with plasmids such as pBR322 LacZ complementation (“blue-white selection”) will work with plasmids (pUC19 is a good example) and also phage (typically M13; also used in variants of lambda) Spi selection Specific for lambda replacement vectors cI selection Can be adapted for both insertion and replacement vectors

Useful features – lacZ complementation (1) Visual identification of recombinant clones using lacZ lacZ gene encodes -galactosidase portion of the lacZ gene (LacZ’, N terminal 146 aa) is incorporated into cloning vector (encodes promoter and -peptide) - this region of the protein is by itself inactive vector also contains regulatory sequences that bind Lac repressor (which keeps the lacZ gene repressed except in presence of inducer IPTG) lacz promoter region (also binds the LacI repressor) LacZ’ (-peptide) pUC19 2686 bp amp lacZa mcs ori

Useful features – lacZ complementation (2) E. coli host plasmid lacZa mcs -gal N terminus (peptide): engineered to express only the -gal C terminus: transform E.coli with plasmid, add IPTG (inducer of LacZ’) and X-gal (chromogenic substrate) active -gal (complementation) turns substrate BLUE - observe blue colonies (or plaques) lacZa

Useful features – lacZ complementation (3) polylinker cloning site is positioned within the LacZ’ region of plasmid or phage (does NOT itself interupt reading frame or synthesis of LacZ -peptide) insertion of foreign DNA within polylinker usually disrupts LacZ’ reading frame - -peptide not made and hence no -gal formed on introduction into host foreign DNA peptide reading frame disrupted, no gal formed; WHITE colonies or plaques recombinant parent vector polylinker lacZa (LacZ’) -peptide; -gal formed blue colonies or plaques in appropriate host E. coli

Genomic clones and libraries + vector DNA (e.g. cosmid) genomic DNA fragments genomic DNA ligate and introduce into host bacteria - each colony contains a recombinant that contains a different genomic DNA fragment GENOMIC CLONE: a recombinant DNA containing a DNA fragment derived from the nuclear DNA (genome) of the organism GENOMIC LIBRARY: collection of clones which together contains copies of all the nuclear DNA (genome) of the organism

Note differences between cDNA and genomic libraries 1. Genomic libraries represent all sequences present in the nuclear genome nearly all genes are cloned with equal probability (genome contains equal number of copies of most genes, therefore all are equally represented in starting genomic DNA preparation) clones from eukaryotes may contain introns and flanking regions of genes many clones will contain sequences that are not expressed as mRNA may be specifically used for cloning sequences from nuclear DNA other than those coding for mRNA (i.e. other than genes ) e.g. cloning of telomeres (ends of chromosomes) or repetitive DNA.

Genomic libraries – ‘Size is important’ 1. Preparation of insert genomic DNA important to have pure, high MW DNA, free of nicks 2. Fragment genomic DNA to suitable size for ligation into vector want 20-25 kb for replacement vector; 40 kb for cosmid vector complete digestion with restriction enzyme would generate many fragments that are too small to clone in or cosmid vectors and would not therefore be represented in library e.g. EcoRI sites: E 4 kb 1 kb 20 kb 2 kb - only the 20 kb clone would be represented in the library (site size and frequency)

Genomic libraries – Partial digests partially digest genomic DNA with frequently cutting restriction enzyme e.g. Sau3A - get cleavage of random subset of sites and generates random collection of fragments purify fragments within desired size range (e.g. 20-25 kb) gel electrophoresis or sucrose gradient centrifugation EcoRI: G`AATTC On average: once per 4096 bp Sau3A: `GATC On average: once per 256 bp BamHI: G`GATCC On average: once per 4096 bp

Genomic libraries – cosmid vector as example ligate purified insert DNA into lambda arms or cosmid vector random genomic fragments Sau3A + cos left arm right arm lambda replacement vector arms purified away from stuffer BamHI Follow it through (you should be familiar with the approach by now). recombinant concatemer B/S S/B

Genomic libraries – Plaques are clonal! package recombinant concatemer into phage particles in vitro each phage contains a distinct piece of genomic DNA infect E. coli each plaque contains many identical phage different plaques contain different phage, each carrying a distinct fragment of genomic DNA

How many clones do I need for a genomic library? want ALL genomic sequences to be represented mammalian genome = 3 x 109 bp DNA if average insert size is 15 kb, approx 200,000 phage carry one genome’s worth of DNA But it’s very unlikely we’ll get just one clone for each piece of DNA. We’ll need much more, perhaps 1 to 2 x 106 phage to ensure all sequences are represented

Clones required for libraries of different organisms no. clones required library insert size: species genome size 17 kb 35 kb E. coli 4.8x106 850 410 S. cerevisiae 1.4x107 2,500 1,200 D. melanogaster 1.7x108 30,000 14,500 Tomato 7x108 123,500 59,000 Human 3x109 529,000 257,000 Frog 2.3x1010 4,053,000 1,969,000 (p = 95%)

Ordered, overlapping libraries used to be required for genome sequencing

Ordered, overlapping libraries used to be required for genome sequencing From ordered library “Shotgun” approach

Building up whole genome sequences >File 1023 GGATCCGGCCACCACGACGGTGCACGACGTACTGCAACGGCTCAACCACGGCCTCATCCGCGGCGACAGCTCGTCCAGCAGCGTCGAGGAGTACCGCGCGGAGATCGAGGAGGCCGGCTTCCGGGTGCGGCAGGCGGAGCGCATCGACAACCTCCTCGGTGACTGGCTGATAGTCGCCGTCAAGCCCTGACCCTGCGTGGCCGCCCTTGCTACCGTGATCATGCCCGCGGGTGTGTTCCCGCCGGGCGGATCACAGCGACGTCAGAGAGGGCGGAACGATGCGGCAGGCGACCACGAATCCGGCAGGAAAGGTCCGCATCACGACGCTAAGGAATCCGAACCCCCTCCATGAACAAGCTGAATCTGGGCATCCTGGCCCACGTTGACGCCGGCAAGACCAGCCTCACCGAGCGCCTGCTGCACCGCACCGGTGTGATCGACGAGGTCGGCAGCGTGGACGCCGGCACCACGACGACCGACTCGATGGAGCTGGAGCGGCAGCGCGGCATCACCATCCGGTCCGCCGTGGCCACGTTCGTCCTGGACGATCTCAAGGTCAACCTCATCGACACCCCGGGCCACTCCGACTTCATCTCCGAGGTCGAGCGGGCGCTCGGGGTGCTCGACGGCGCGGTCCTGGTGGTCTCGGCCGTCGAGGGCGTCCAGCCGCAGACCCGCATCCTGATGCGGACCCTGCGCAGGCTGGGCATTCCCACGCTGGTCTTCGTCAACAAGATCGACCGGGGCGGCGCGCGTCCCGACGGTGTGCTGCGGGAGATCCGCGACCGGCTCACCCCCGCCGCGGTGGCACTGTC >file 6492 GAGATCCGCGACCGGCTCACCCCCGCCGCGGTGGCACTGTCCGCCGTGGCGGACGCCGGCACGCCGCGGGCCCGCGCGATCGCGCTCGGCCCGGACACCGACCCGGACTTCGCCGTCCGGGTCGGTGAGCTGCTGGCCGACCACGACGACGCGTTCCTCACCGCCTACCTGGACGAGGAACACGTACTGACCGAGAAGGAGTACGCGGAGGAACTGGCCGCGCAGACCGCGCGCGGTCTGGTGCACCCGGTGTACTTCGGGTCCGCGCTGACCGGCGAGGGCCTGGACCATCTGGTGCACGGCATCCGGGAGTTGCTGCCGTCCGTGCACGCGTCGCAGGACGCGCCGCTGCGGGCCACCGTGTTCAAGGTGGACCGTGGCGCGCGCGGCGAGGCCGTCGCGTACCTGCGGCTGGTCTCCGGCACGCTGGGCACCCGCGATTCGGTGACGCTGCACCGCGTCGACCACACCGGCCGGGTCACCGAGCACGCCGGACGCATCACCGCGCTGCGGGTCTTCGAGCACGGGTCGGCCACCAGCGAGACCCGGGCGACCGCCGGGGACATCGCGCAGGCGTGGGGCCTGAAGGACGTACGGGTCGGTGACCGGGCCGGGCACCTCGACGGTCCCCCGCCGCGCAACTTCTTCGCGCCGCCCAGCCTGGAGACCGTGATCAGGCCGGAGCGCCCGGAGGAAGCGGGACGGCTGCACGCCGCGCTGCGCATGCTGGACGAGCAGGACCCCTCGATCGACCTGCGGCAGGACGAGGAGAACGCGGCCGGCGCGGTGGTCCGCCTCTACGGGGAGGTGCAGAAGGAGATCCTCGGCAGCACGCTCGCGGAGTCCTTCGGCGTACGGGT

Building up whole genome sequences >Contig c34 GGATCCGGCCACCACGACGGTGCACGACGTACTGCAACGGCTCAACCACGGCCTCATCCGCGGCGACAGCTCGTCCAGCAGCGTCGAGGAGTACCGCGCGGAGATCGAGGAGGCCGGCTTCCGGGTGCGGCAGGCGGAGCGCATCGACAACCTCCTCGGTGACTGGCTGATAGTCGCCGTCAAGCCCTGACCCTGCGTGGCCGCCCTTGCTACCGTGATCATGCCCGCGGGTGTGTTCCCGCCGGGCGGATCACAGCGACGTCAGAGAGGGCGGAACGATGCGGCAGGCGACCACGAATCCGGCAGGAAAGGTCCGCATCACGACGCTAAGGAATCCGAACCCCCTCCATGAACAAGCTGAATCTGGGCATCCTGGCCCACGTTGACGCCGGCAAGACCAGCCTCACCGAGCGCCTGCTGCACCGCACCGGTGTGATCGACGAGGTCGGCAGCGTGGACGCCGGCACCACGACGACCGACTCGATGGAGCTGGAGCGGCAGCGCGGCATCACCATCCGGTCCGCCGTGGCCACGTTCGTCCTGGACGATCTCAAGGTCAACCTCATCGACACCCCGGGCCACTCCGACTTCATCTCCGAGGTCGAGCGGGCGCTCGGGGTGCTCGACGGCGCGGTCCTGGTGGTCTCGGCCGTCGAGGGCGTCCAGCCGCAGACCCGCATCCTGATGCGGACCCTGCGCAGGCTGGGCATTCCCACGCTGGTCTTCGTCAACAAGATCGACCGGGGCGGCGCGCGTCCCGACGGTGTGCTGCGG GAGATCCGCGACCGGCTCACCCCCGCCGCGGTGGCACTGTCCGCCGTGGCGGACGCCGGCACGCCGCGGGCCCGCGCGATCGCGCTCGGCCCGGACACCGACCCGGACTTCGCCGTCCGGGTCGGTGAGCTGCTGGCCGACCACGACGACGCGTTCCTCACCGCCTACCTGGACGAGGAACACGTACTGACCGAGAAGGAGTACGCGGAGGAACTGGCCGCGCAGACCGCGCGCGGTCTGGTGCACCCGGTGTACTTCGGGTCCGCGCTGACCGGCGAGGGCCTGGACCATCTGGTGCACGGCATCCGGGAGTTGCTGCCGTCCGTGCACGCGTCGCAGGACGCGCCGCTGCGGGCCACCGTGTTCAAGGTGGACCGTGGCGCGCGCGGCGAGGCCGTCGCGTACCTGCGGCTGGTCTCCGGCACGCTGGGCACCCGCGATTCGGTGACGCTGCACCGCGTCGACCACACCGGCCGGGTCACCGAGCACGCCGGACGCATCACCGCGCTGCGGGTCTTCGAGCACGGGTCGGCCACCAGCGAGACCCGGGCGACCGCCGGGGACATCGCGCAGGCGTGGGGCCTGAAGGACGTACGGGTCGGTGACCGGGCCGGGCACCTCGACGGTCCCCCGCCGCGCAACTTCTTCGCGCCGCCCAGCCTGGAGACCGTGATCAGGCCGGAGCGCCCGGAGGAAGCGGGACGGCTGCACGCCGCGCTGCGCATGCTGGACGAGCAGGACCCCTCGATCGACCTGCGGCAGGACGAGGAGAACGCGGCCGGCGCGGTGGTCCGCCTCTACGGGGAGGTGCAGAAGGAGATCCTCGGCAGCACGCTCGCGGAGTCCTTCGGCGTACGGGT

Current uses of gene libraries Many cosmid libraries were the substrates for genome sequencing projects, so now obtain desired clone by analysing the sequence data. More often than not clones can be ordered by email; While genomic clones are good substrates for PCR, genomic DNA can also be used for most purposes. Direct PCR amplification becomes less reliable the bigger the genome - use libraries when you can! Genetic tests, e.g. functional complementation; Although construction of genomic libraries no longer critical for genome sequencing project, still valuable for functional genomics. The ‘foreign’ DNA can be manipulated in E. coli (i.e. creation of gene modifications/disruption) and then transferred into original organism – functional genomics.