DNA technology Gene cloning (making more copies of genes) Genetic modification of organisms (genetic engineering) Gene therapy (treating genetic disorders) Gene sequencing (finding out the base sequence) Genetic fingerprinting (unique pattern of certain base sequences)

What is a gene? A sequence of DNA nucleotides which code for a particular protein.

What is a genome? The entire DNA sequence of an organism (i.e. all the DNA both coding and non- coding). The Human Genome Project successfully mapped the human genome in 2003

1.Using reverse transcriptase 2.Using restriction endonucleases 3.Producing multiple copies by PCR

2 different enzymes can be used to remove fragments of DNA from chromosomes: Reverse transcriptase Restriction endonuclease.

1. Using reverse transcriptase: What is transcription? Formation of mRNA from DNA What do you think the enzyme reverse transcriptase does? Makes DNA from mRNA As the DNA which is produced has complementary nucleotides to mRNA it is called complementary DNA or cDNA.

Notes for p1 mRNA is isolated from cells, mixed with nucleotides and reverse transcriptase, and the enzyme uses the mRNA as a template to produce cDNA for a particular gene from that gene’s mRNA. Why is this useful? The cell contains lots of copies of mRNA, but only 2 copies of a gene, so the mRNA is easier to obtain

A bit more info: Reverse transcriptase is an enzyme found in retroviruses such as HIV.

2. Using restriction endonuclease: The second way to isolate the gene you is done by an enzyme called a restriction endonuclease Each restriction endonuclease recognises a different DNA base sequence

Restriction endonuclease enzymes. E coli bacterium Eco R1 restriction enzyme Think back to your work on protein structure (module 1). Why does each enzyme molecule recognise a different DNA base sequence? The enzyme’s active site has a specific shape which is complementary to the shape of a specific DNA base sequence. Complete the question at the bottom of page 1 in your booklet now.

G A A T T C C T T A AG

Now complete the table on page 2 (the first has been done for you).

CC T A G G GG A T CC

TT C G A A A A G C TT

G A C G T C C T G C AG

C G G A C C G G C C T G G C

TCCGGACCGACGTCGGTTCGAATC AGGCCTGGCTGCAGCCAAGCT TAG Use a different colour to identify where each enzyme cuts. (NB Eco R1 is not used – some of the others may not cut either)

TCCGGACCGACGTCGGTTCGAATC AGGCCTGGCTGCAGCCAAGCT TAG

Answer the summary question pg 248 text book

All sequences recognised by restriction enzymes are palindromes.

Palindromes… Was it a rat I saw?“ If I had a hi-fi. Mr. Owl ate my metal worm.

PCR This technique can be used to produce multiple copies of DNA fragments

Polymerase Chain Reaction (PCR) 52KwKo&feature=related The specific fragments of DNA are then amplified by

What is the Polymerase Chain Reaction? Poly …………. Many ase…………… enzyme Chain………… linking Reaction…….. Reactions! The purpose of a PCR (Polymerase Chain Reaction) is to make a huge number of copies of a gene.

A metaphor for PCR is… molecular photocopying

Requirements pg 3 booklet DNA polymerase – enzyme which joins DNA nucleotides together to form a new DNA strand. Primers – short single-stranded sequence of nucleotides which are complementary to those at one end of the DNA strand to be copied. Nucleotides – which contain each of the four bases found in DNA Thermocycler – a computer controlled machine that varies temperatures over a period of time.

PCR Cycle Strand separation 1.Separate DNA strands by heating to 95 0 C

Binding of primers 2.Cool to 55 0 C for 30 seconds and add primers Primers bind to complementary strands PCR Cycle

DNA synthesis 3. Heat to 72 0 C PCR Cycle

DNA synthesis 3. Heat to 72 0 C DNA polymerase enzyme binds to primers (72 0 C is the optimum temp for this DNA polymerase) PCR Cycle New strands of complementary DNA are made using the old ones rom the nucleotides present in the mixture

PCR Cycle Strand separation 1.Separate DNA strands by heating to 95 0 C BUT!!! Now there are 2 copies of DNA so this cycle will produce double the number of DNA molecules.(4) Next cycle will produce double the number of DNA molecules (8)

25 cycles will produce more than a million DNA molecules!

Green algae in hot water at Waimangu Thermal Valley, New Zealand. Algae possess thermostable enzymes

PCR animation

Were you paying attention? 1.At what temp is the double stranded DNA split into 2 single stranded templates? 2.How long is the mixture cooled for? 3.What binds to the DNA during cooling? 4.What is the optimum temp for DNA polymerase enzyme to bind to primer? 5.What builds the new strands of DNA? 6.Why is the cycle repeated?

So were you? Click for answers 1.At what temp is the double stranded DNA split into 2 single stranded templates? 2.How long is the mixture cooled for? 3.What binds to the DNA during cooling? 4.What is the optimum temp for DNA polymerase enzyme to bind to primer? 5.What builds the new strands of DNA? 6.Why is the cycle repeated? 95 0 C Primers 72 0 C DNA polymerase To double the number of DNA molecules 30s

Now answer the summary questions on page 255

Summary of the steps involved in the polymerase chain reaction. These stages are carried out on a PCR machine. primer 1 primer 2 single stranded DNA free nucleotides heat to separate strands DNA polymerase extends primer, joining complementary bases to each single DNA strand replication of each strand complete process repeated with each new strand double stranded DNA DNA sequence to be amplified

PCR is…. …A very accurate method of making many copies from a DNA molecule. To start the process short base sequences, known as are needed. These provide the starting sequence for DNA. The following are also needed: the stranded DNA that is being replicated, nucleotides and the enzyme DNA. Fill in the gaps using the words below. Use the space bar to reveal the answers. singleprimersreplicationdoublepolymerase

Well Done!

DNA Technology overview 1.Obtain the DNA fragment required – using reverse transcriptase or restriction endonuclease enzymes 2.Amplify the fragment using PCR 3.Either: Identify fragments using electrophoresis (for sequencing, mapping or genetic fingerprinting) Or: Use fragments in gene therapy

N.B sometimes PCR is used to amplify the number of fragments of DNA before inserting DNA into bacteria. For the next section of genetic engineering we will look at in vivo gene cloning.

In vitro vs in vivo gene cloning. PCR is a method of in vitro gene cloning As a fast process, PCR allows you to produce lots of the specific DNA fragment you want very quickly. However, PCR is expensive and only really suitable if you want small fragments of DNA.

In vitro vs in vivo gene cloning. Genes can also be cloned in living organisms i.e. in vivo. Bacteria are usually used as they are easy to culture and replicate rapidly.

This allows mRNA as well as DNA to be produced, modifications can be made to the DNA and large fragments can be produced. However – it is a slow process and the DNA must be separated from the rest of the cell contents.

Idea of genetically modified organisms When a foreign gene is inserted into a host cell the host can manufacture the protein it codes for. DNA which contains a foreign gene is called recombinant DNA. An organism that contains recombinant DNA is a transgenic or genetically modified organism

Transgenic organisms A transgenic organism has a foreign gene inserted into its DNA i.e. it has recombinant DNA. The GloFish is a trademarked brand of genetically modified (GM) fluorescent zebrafish with bright red, green, and orange fluorescent color. Although not originally developed for the ornamental fish trade, it is the first genetically modified animal to become publicly available as a pet.

Uses of in vivo gene cloning Improve the resistance of cereal crops to weed killers. The heart of a pig with a human gene could be used in heart transplants may be less likely to be rejected. Gene therapy – inserts a healthy gene into diseased tissue to “cure” a person e.g. a cystic fibrosis sufferer

Tracy the Sheep Tracy the sheep ( ) who produced a chemical in her milk useful for sufferers of cystic fibrosis.