Humoral immunity Antibody structure Antibody diversity B-cell activation Antibody production Effector mechanisms

Immunoglobulin (Ig) structure 2 heavy chains, 2 light chains 2 identical Ag binding sites VL + VH 3 hypervariable CDRs Constant portion binds: complement phagocyte receptors chime model Immunoglobulin fold

Antibody diversity VDJ recombinase rearranges DNA during B-cell development k light chain heavy chain C (constant) segment C segments for each isotype 35 “V” segments 45 “V” segments 5 “J” segments 20 “D” segments 6 “J” segments  light chain heavy chain 4C (constant) segments 30 “V” segments 4 “J” segments True or False: Every cell in the human body has the same DNA sequence FALSE! T and B cells do not have the same sequence as other cells; each type has a unique sequence We need to recognize at least 105 to 106 different Ag…but we have only about 30,000 genes! How can we produce the needed diversity??

Antibody diversity Combinatorial diversity Selection of V, D and J segments Junctional diversity Removal of bases by exonucleases Insertion of bases by TdT P-nucleotides CDR3 (most variable) is at V(D)J junction GACTACATACCATACCTACAGGCATACATCGAATGA V D >1011 possible combinations, considering both combinatorial and junctional diversity GACTACATACCAT ATACATCGAATGA GACTACATAC ATCGAATGA GACTACATACACATCGAATGA VD

Isotypes 1 heavy-chain gene Different constant regions: Cg → IgG IgG, IgA, IgD, IgE IgM Isotypes 1 heavy-chain gene Different constant regions: Cg → IgG Cm → IgM Ca → IgA Ce → IgE Cd → IgD

Isotypes IgG – major Ab, monomer IgA – secreted Ab, dimer IgM – first Ab made, pentamer (monomer as Ag receptor) IgE – parasites & allergies, monomer IgD – Ag receptor, monomer

Antigen recognition B cells can recognize: Proteins Polysaccharides Lipids Nucleic acids Small molecules (e.g., toxins) (strongest response; requires TH) T-dependent (weaker response but no TH needed) T-independent What types of Ag can B cells recognize? How are these responses classified? Which response is stronger?

Antigen recognition B cells find Ag in follicles of lymph nodes and spleen “Filter” blood and lymph Concentrate Ag Ag enters in blood, lymph or transported by DC cells

Antigen recognition No Ag processing Ag receptor (BCR) = membrane-bound IgM or IgD Where do B cells encounter Ag? Follicles of lymph nodes and spleen (B-cell area)

B-cell activation Receptor cross-linking required (multivalent Ag) Signal transduction poor activation What is the receptor for Ag? How does Ag initiate an activating signal? Receptor cross-linking is required One reason why a protein Ag produces a weaker response in absence of TH Multivalent Ag (e.g., polysaccharide, whole organism, aggregate, etc.) good activation

B-cell activation Proliferation Expression of B7 and cytokine receptors Migration out of follicles Down-regulation of follicle chemokine receptors Secretion of IgM Migration away from B cell areas of follicles is needed to encounter T cells Note that IgM is first Ab to be secreted (pentameric form)

B-cell activation Endocytosis, processing and display of Ag APC for activated TH cells

B-cell activation Activated TH: CD40L Cytokines (IL-4, IFN-g, TGF-b) Stimulates B cell: Clonal expansion Ab production Isotype switching Clonal Expansion

B-cell activation B and T cells can recognize different epitopes protein Ag polysaccharide Ag epitope of protein Ag B cell TH cell

Differentiation Plasma cells Reside in lymph node Secrete Ab Memory cells Reside in bone marrow Secrete Ab at low level Activate quickly on re-exposure plasma cell

Affinity maturation Ab made later in infection has higher affinity for Ag Even higher affinity in secondary response In what sense do we make “better” antibody as the response to infection progresses?

Affinity maturation Some activated B cells enter follicles → germinal centers Proliferation Hypermutation of V domains (1 mutation/1000 bp/cell/generation)

Follicular dendritic cell (FDC) Affinity maturation Germinal center B cells die unless they interact with FDCs As [Ag] decreases, competition selects for increased affinity Ag Ab Fc receptor DC Follicular dendritic cell (FDC)

Antibody feedback Fc receptors on B cells When Ab levels are high, B cell binds Ab-Ag complex Fc receptor blocks receptor signalling

How do antibodies work? V: antigen binding CH2: Fc receptor binding complement binding CH3: Fc receptor binding

Antibody functions Neutralization Opsonization Antibody-dependent cell-mediated cytotoxicity (ADCC) Activation of complement Specialized roles: Mucosal immunity Neonatal immunity

Neutralization What is it? Bind virus, cell or toxin Requirements: Ig classes: Effective against: Bind virus, cell or toxin Prevent attachment to cell or receptor Ab only IgM, IgG, IgA viruses and toxins especially can be effective against bacteria

Opsonization What is it? Requirements: Ig classes: Effective against: Coat microbe (opsonin) Enhance phagocytosis Ab, phagocyte with FcgRI receptor IgG (IgG1 and IgG3) bacteria, especially with capsules viruses when extracellular

ADCC What is it? Requirements: Ig classes: Effective against: Target NK cell or eosinophil to infected cell or parasite Ab, NK (FcgRIII) or eosinophil (FCeRI) IgG for NK, IgE for eosinophils intracellular pathogens, parasites

Activation of complement Ab (IgG or IgM) binds Ag C1 binds two adjacent Fc regions Proteolytic activation of complement proteins Opsonization (C3b) Activation of B cells (C3d) Inflammation (C5b) Bacterial lysis (MAC)

Mucosal immunity What is it? Requirements: Ig classes: Effective against: Secretion of Ab into respiratory and gastrointestinal tracts Ab, epithelium with poly-Ig receptor IgA bacteria, viruses and toxins

Neonatal immunity What is it? Requirements: Ig classes: Effective against: Passive immunity protects newborn during development of immune system Ab, newborn cells with FcRn IgG via placenta, IgA and IgG in milk bacteria, viruses and toxins (depends on mother’s immunity)