Ppt on places in our neighbourhood

An introduction to the portfolio from Place Directorate Neighbourhood and Community Services Overview and Scrutiny Committee 30 th July 2015.

on super diverse / youngest city in UK Our shared Council mission “Making a positive difference every day to people’s lives” Our values Putting residents first – we are empathetic and respectful. Being true to our word – we make promises and we/and programme delivery within the Council and beyond to ensure that the gap in social, economic and environmental outcomes for citizens and communities is closed. Place Services: Neighbourhoods Service Director: Ifor Jones Telephone: 0121 303 4595 Email: ifor.jones@/


1 Joint Area Review of Children’s Services in Lincolnshire (JAR) www.lincolnshirechildren.net Every Child Matters in Lincolnshire Children and Young People’s.

voluntary and community sector and others, contribute to the five outcomes  asking us to identify our priorities for children and young people  seeing whether our plans and policies are implemented and reviewed  asking how well we engage with children and young/ 3 neighbourhood areas. The inspection team will choose one or two to visit and look at in more detail.  A neighbourhood study should take place in an area where: the percentage of children and young people who live in the area is in line with/


Emerging plans at local and neighbourhood level Sarah O’Driscoll Service Manager City Planning 22 nd April 2014.

April 2014 PAS London 22 nd April 2014 Content Bristol’s statutory planning context How we have been working with our Neighbourhood Forums the challenges the opportunities Some of the lessons and learning to date Bristol – West of England Sub-region 22/has got ahead of the Local Plan preparation Where Statutory Local Plan in place Where the local authority is the major land owner In each case…. What is the added value that a Neighbourhood Development Plan can offer How can the NPF contribute to the existing/


TOTAL POLICING Most effective, efficient, loved & respected force in the UK Greatest and safest big city on earth Public services and communities tackling.

wards within the borough 1 23 4 The Neighbourhood will be managed by a Neighbourhood Inspector Non-dedicated ward officers and PCSOs will work across wards within a Neighbourhood Officers on Neighbourhoods will investigate low-risk crimes and solve long term issues in the community Our Commitments – Your Priorities Date Arial 14pt TOTAL POLICING Our Commitments Your Priorities Safer Neighbourhoods Teams will make 5 commitments that will be/


Your town – your plan Bishop’s Stortford Neighbourhood Plan All Saints, Central, South and part of Thorley Neighbourhood Plan Team Meeting 17 th February.

mitigation implemented to avoid placing additional pressure on existing estate roads in Thorley Park (evidence traffic surveys). Traffic flows to be analysed and mitigation implemented to avoid placing additional pressure on existing estate roads in Thorley Park (evidence / and options Create vision Objective Policies and proposals Reasoned justification Policies and proposals Making effective policies for our Neighbourhood Development Plan (NDP) The Do’s and Don’ts of Policy writing. Don’t Try covering/


The National Urban Design Conference 2015 - Bristol Development, Design and Profit in C21 How developers and society can profit from well designed towns.

physical activity, for instance: High connectivity mixed neighbourhoods Land use mixture public transport, pedestrian facilities or proximity Green spaces, signage Neighbourhood aesthetics used to design-in walking and cycling in our daily lives (Saelens, Sallis and Frank, 2003/) Have we got the right national and local planning policies and processes, design guidance and partnerships in place to tackle obesity? Urban planning policy to promote healthy weight environments Section 8 of the National Planning/


A better neighbourhood Chapter 2, Book 5A New Welcome to English (Second Edition)

2, Book 5A New Welcome to English (Second Edition) What places are there in Mary’s neighbourhood? a dental clinic? Is there a dental clinic in your neighbourhood? Yes, there is. We can go to the dentist there. a library? Is there a library? No, there/ Chai Wan Hong Kong 17th September 2001 We need a clinic and a car park. We cannot go to the doctor or park our cars in our neighbourhood. Write your address and the date here. Write a paragraph about one main idea. Write an ending. Write your name and who/


ASHINGTON PARISH Neighbourhood Plan What is a Neighbourhood Plan? It is a PLANNING DOCUMENT for Ashington Parish: Sets out what our village needs eg houses,

make sure any new homes are in the right places – sustainable development To match infrastructure to population size – homes, transport, employment, education, healthcare, community facilities To protect our environment – trees, woods, ponds, green fields, wildlife etc To preserve our village status – small scale growth To prevent inappropriate development To meet community needs/wishes. New homes = community money ASHINGTON PARISH Neighbourhood Plan The reality of Planning/


Good, with many prospects for better - Managing growth in the Edmonton Metro Region Jim Hiley, P.Ag. and Candace Vanin, P.Ag. Land Use Decision Support.

a comprehensive approach - and ‘one size does not fit all’ * Recognize and respect the ‘Sense of Place’ of local communities … the principles we follow in our work … Source: LUDS Unit, AAFC. November, 2005. Draft Land Use Strategy: Internal and not for circulation/com/ (C) Strive to develop a livable region * Growing literature on ‘sense of place’ is informative* * Why not plan for both rural and urban neighbourhoods? * Monitor the diversity of people, plants & animals therein * This diversity is fundamental/


Strategic environmental assessment for neighbourhood plans London, 27 th October 2015 www.pas.gov.uk.

with the Basic Conditions Basic Condition E Neighbourhood plans must be in “general conformity with the strategic policies” of the development plan What if there’s no NPPF-compliant local plan in place? What if there’s no specific target/ need to define housing market area Other areas of commonality or potential commonality LPA guidance particularly valuable here Our guidance includes a table of commonalities and differences Commonalities between SHMA and NP HNA NPPG-recommended SHMA approachNeighbourhood /


Neighbourhood planning: developing neighbourhoods, not paperwork 13 th March 2013www.pas.gov.uk.

Local Plan Councillor workshop - getting your plan in place: good plan making, housing numbers and evidence (Birmingham) 26 March 2013 (free) Further support, briefings and training Other resources: Community Knowledge Hub http://planning.communityknowledgehub.org.uk/ http://planning.communityknowledgehub.org.uk/ Community Planning http://www.communityplanning.net/index.php http://www.communityplanning.net/index.php Our Neighbourhood Planning http://www.ourneighbourhoodplanning.org.uk/home/


Neighbourhood Planning Legal Update and understanding the Basic Conditions 11 February 2016www.pas.gov.uk.

health, social and cultural well-being. an Environmental role: contributing to protecting and enhancing our natural, built and historic environment; and, as part of this, helping to improve bio/in place in my LPA and how do I do it? Feedback Resources Suite of Locality guidance NPPG Planning Aid website PAS website, including briefing notes, FAQs, compliance checklist, Model Service Level Agreement #neighbourhoodplanning www.ourneighbourhoodplan ning.org.uk Relevant (policy based) PAS events Neighbourhood/


Towards Lifetime Neighbourhoods Planning sustainable communities for all Ed Harding International Longevity Centre UK Y&H HLIN, Hedon 17 th April 2008.

. London, ICS, 232pp With a rising number of people living alone, our communities must offer safe, attractive and accessible places for social interaction. 2007 Housing Green paper: 3 million new homes by 2020 Up to 5 new ‘eco-towns’ 29 Growth points in 45 towns and cities 2. Why plan for lifetime neighbourhoods? Key drivers: Older people’s economic, civic and social contribution 5/


Www.ohip.org.uk Oldham Housing Investment Partnership OHIP “Building stronger neighbourhoods for all our Oldham residents”

stronger neighbourhoods for all our Oldham residents” www.ohip.org.uk 2 OHIP – A key to Oldham Partnership Aksa Homes Contour Homes (part of Symphony group) First Choice Homes Oldham Guinness Northern Counties Great Places Housing Group Housing 21 Oldham Council Places for / Strategy 2012 -15 www.ohip.org.uk 7 Vision and Aims Vision: By working in effective partnership with others to help make Oldham a better place to live and to increase the life opportunities for residents. Aim: To influence, support/


Off-licence Shopkeepers Experience of Alcohol Issues :The government is not here to stand in the shop and see what its like Alasdair Forsyth Co-app: Anne.

[male staff] especially that if we were ever to lose our licence it would have a massive impact on our business. The two most vital components to our business are the post-office and an off-license. If / into the environmental impact of off-license premises on residential neighbourhoods MRC research publication: Ellaway, A, Macdonald, L., Forsyth, A.J.M. & MacIntyre, S. (2010) The socio-spatial distribution of alcohol outlets in Glasgow city. Health & Place, 16: 1, 167 - 172. Forthcoming book chapter:/


Neighbourhood Effects and the Welfare State. Towards a European research agenda? Roger Andersson Institute for Housing and Urban Research Uppsala university,

our knowledge about segregation dynamics and effects of segregation on the social trajectories of individuals. A research programme on neighbourhood mix and neighbourhood effects The Micro Structure of the Housing Stock (neighbourhoods composition in terms of tenure and housing types) Social and Ethnic composition of neighbourhoods/ (3) all residents in Sweden can be localised both in terms of housing and work places. This allows for the study not only of static distributions at any point in time but also of/


How localism and experience from pioneers is playing out in rural England; key issues, lessons and learning Ivan Annibal.

aims The Government is giving neighbourhoods greater ability to determine the shape of the places Empower communities Neighbourhood led Light-touch but robust Flexible - inspire innovation and creativity Pro-growth - exploring ways of enabling community supported development Critical role for local plan in setting strategic context New basis for partnership work with local authority Neighbourhood Planning mechanisms Neighbourhood Development Plans: Communities can write a plan which/


Centre for Housing Research, University of St Andrews Occupational mobility and neighbourhood effects: a longitudinal study ESRC Seminar Series – 4 & 5.

that contribute to their poverty in the first place.” (Paul Cheshire, JRF, 2007) “do poor people live in poor neighbourhoods because living in affluent ones costs too much? Or does living in a poor neighbourhood make poor people significantly poorer?”/reversed causality. –Existing longitudinal studies show no evidence of neighbourhood effects or benefits from deconcentrating poverty. Centre for Housing Research, University of St Andrews Our contribution to the literature Individual level analysis (avoids the/


Pride of Place: Who Cares? Who Leads? Residents and Partners Working Together for Change.

Pride of Place: Who Cares? Who Leads? Residents and Partners Working Together for Change Content Overview of area Overview of the POP Partnership aims and objectives The Quality Mark – how was it for us? Our Neighbourhood Action Plan Empowering residents – what works for us Co-production Originally built in 1926 under ‘Homes for Heroes’ scheme but estate fell into decline in the 1980s Completely redeveloped between/


Www.iNbiz.org iN business for neighbourhoods The Housing Association Movement Pat Brandum Regional Chair, NHF Chief Executive, West Mercia Housing Group.

– part of the National Housing Federation’s iN Business for Neighbourhoods campaign www.iNbiz.org iN business for neighbourhoods Manifesto for Neighbourhoods www.iNbiz.org iN business for neighbourhoods Manifesto for neighbourhoods Sustainable neighbourhoods – a national priority … meeting aspirations … investing for success … a place for everyone … renewing our towns … supporting rural life … achieving excellence www.iNbiz.org iN business for neighbourhoods Sector must meet ODPM efficiency target or risk/


1 Neighbourhoods matter: spill-over effects in the fear of crime Ian Brunton-Smith Department of Sociology, University of Surrey.

neighbourhood disorder, subcultural diversity Policy – community policing, safer neighbourhoods, reassurance policing, CSOs But limited understanding of ‘neighbourhood’ and methodological weaknesses 2 Our study The role of neighbourhoods in shaping individual fear  Key mechanisms, limitations of existing work Detailed neighbourhood analysis  Defining neighbourhoods/anybody, while in the street or any other public place?  ‘not at all worried’ (1), to ‘very worried’ (4) Neighbourhood Measure Working /


Localism Act, Neighbourhood Planning & the Draft National Planning Policy Framework Andrew England Assistant Head of Planning and Regeneration.

But the presumption in favour of sustainable development is not a green light for wind turbines everywhere. Draft NPPF Myth: Not only will there be more development, it will ugly and uncontrolled Fact: As with key environmental protections, our historic environment, / a local plan is in place which has the support of the local community that is what will drive decision making. It will no longer be possible for Inspectors to enforce changes to local plans and neighbourhood planning powers will give real/


Biologically Inspired Computing: Evolutionary Algorithms: Hillclimbing, Landscapes, Neighbourhoods This is lecture 4 of `Biologically Inspired Computing’

zero. 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Neighbourhoods Let s be an individual in S, f(s) is our fitness function, and M is our mutation operator, so that M(s1)  s2, where s2 is a mutant of s1. Given M,/ the end of the gene, owing to something about the pattern of nucleotides it finds there. RNA is similar to DNA, but uses `U’ in place of T. CUAGCUCGA RNA Genes  Proteins ACTCGCGATCGAGCTACGAGACTCATGCAGCTATGAC The RNA transcript then finds its way out of the nucleus, and is attracted to a ribosome (/


The Impact of Mature Trees on House Values and on Residential Location Choices in Quebec City Marius Thériault, Ph.D. Yan Kestens, Ph.D. Candidate François.

activity places Spatial statistics –Sorting out property-specific and neighbourhood effects /In order to further our understanding of landscaping valuation in urban regions, economic and behavioural modelling has been combined in a two-step approach: - Hedonic approach to assess economic valuation of property specifics, location and environment - Logistic regression to model households propensity for buying a house on a wooded lot (with mature trees measuring at least 10 metres) and in wooded neighbourhoods/


Neighbourhood Plans What are they, and what is Saltash doing about it? Steve Besford-foster.

wellbeing of all our community. Achieving a sustainable economy – by supporting actions that build prosperity for all and use resources wisely. Promoting good governance – by ensuring that you are all involved in creating the Saltash Neighbourhood Plan. NATIONAL PLANNING/ level, this could multiply the impact of any uplift in the housing figures, particularly for those CNAs judged to be ‘less sensitive’ in environmental terms that are well placed in terms of accessibility. Will Saltash have to find more /


Shropshire Council – Planning for Neighbourhoods Jake Berriman Head of Strategic Delivery.

Localism Transference of power Collaborative plan making Local Plans Place Plans Parish and neighbourhood plans LOCALised planning Parish and Neighbourhood Plans Place Plans SAMDev Core Strategy NPPF Neighbourhood Planning in Shropshire 5 Government Front Runners; Much Wenlock Town Oswestry Town and Lydbury North Parish Kinnerley Parish and in Shrewsbury, Underdale, Monkmoor and Abbey Neighbourhood Forum BUT……. Shropshire: Planning 4 Neighbourhoods... Over 90 existing Town and Parish Plans New opportunities/


The Middleton Cheney Neighbourhood Plan Proposition for Chenderit School To Actively Participate in Preparation of The Middleton Cheney Neighbourhood.

been given real legal power over planning in our community. It will deal with a range of social, economic and environmental issues (such as housing, employment, leisure facilities and transport). It will deal with a range of social, economic and environmental issues (such as housing, employment, leisure facilities and transport). Middleton Cheney Neighbourhood Plan Heritage A Place in history Architectural Recent Trends Demographics Census Data/


1. Neighbourhood Plan Meeting with Governors Kislingbury Primary School December 4 2014 2.

or expand their premises. Transport and access issues (roads, cycling, walking etc.) The provision of leisure facilities, schools, places of worship, health, entertainment, and youth facilities. The protection and creation of open spaces (nature reserves, allotments, sports/into legal force. It will be used to determine planning applications and guide planning decisions in the Parish 5 Context of our Neighbourhood Plan West Northhants Joint Core Strategy – Part 1 Plan Examination Completed Will be presented /


Westminster Briefing Planning Healthy Communities 15 September 2015 Planning Policy’s Role in Addressing Health Challenges Dr Laurence Carmichael Coordinator.

physical activity, for instance: High connectivity mixed neighbourhoods Land use mixture public transport, pedestrian facilities or proximity Green spaces, signage Neighbourhood aesthetics used to design-in walking and cycling in our daily lives (Saelens, Sallis and Frank,/sustainable transport, climate change adaptation/mitigation, sustainable design, local economic growth and better-designed places). But: no national planning policy guidance focusing specifically on reducing obesity and creating healthy /


‘Whaur are you fae’: Class Identity over time and place Scottish Government – Tackling Multiple Deprivation in Communities 2 June 2009 Douglas Robertson.

Places: Riverside, Raploch and Randolph Road Constructing and sustaining of place identity  Construction of neighbourhood  established at an early stage in each neighbourhoods development  historically, socially, culturally defined - ‘imagined’ Anderson  Neighbourhood /neighbourhoods: Bourdieu’s social theory has great relevance – Neighbourhood identity has incredible longevity, Raploch’s identity dates back 550 years Conclusions Study improves our understanding of how class determines neighbourhood/


Salehurst & Robertsbridge Neighbourhood Plan Residents’ Survey Presented on 20 th October 2015 JER/1972.

a village steward for our Parish? Base: All weighted (963) Range by area 54% (2. Andrews, etc) to 80+% (8. Mill Rise, 4 Northbridge St, 6, Station Rd) 76% 10% 12% 2% Salehurst & Robertsbridge Neighbourhood Plan 38. Review funding/ leisure priority is improvements to footpaths, with multi-use court in 2 nd place Employing a village steward much more welcome as a funded initiative than parking review Salehurst & Robertsbridge Neighbourhood Plan 60c. Summary of findings Clear preferences for safety improvements/


Neighbourhood School Involvement TrueCity Conference Workshop 23 April 2005.

Explore the Demographics Formal interviews Formal interviews Finding places to naturally interact with people Finding places to naturally interact with people History of the neighbourhood History of the neighbourhood Story Don Ruddle Bethany Gospel Chapel Connecting through King George Principle 3 Volunteer with the Community in the School Be aware of pushing “our agenda” Be aware of pushing “our agenda” Find out what is already happening Find/


Www.stanw.netfirms.com South Tyneside Association of Neighbourhood Watches STANWSTANW.

. CCTV. www.stanw.netfirms.com The AIMS The aims of Neighbourhood watch is to make our communities better to live in. To increase the quality of life for the community around us. To bring crime down in the area with the help of the Police, Community Wardens, /of gathering evidence for the initial start of an enquiry by a Police Officer. The system would be placed inside the property only. The system would be placed inside the property only. It would go into the property for a period of 7 days then reviewed/


Neighbourhood Planning Legal Update and understanding the Basic Conditions 3 February 2016www.pas.gov.uk.

. 47 General Conformity with Local Plan (5) To further assist QBs in being clear what they have to be in conformity with, our new Local Plan includes a Policy that : sets out clearly the strategic/in place in my LPA and how do I do it? Feedback Resources Suite of Locality guidance NPPG Planning Aid website PAS website, including briefing notes, FAQs, compliance checklist, Model Service Level Agreement #neighbourhoodplanning www.ourneighbourhoodplan ning.org.uk Relevant (policy based) PAS events Neighbourhood/


Place CIL Implementation – the Bristol experience Jim Cliffe (Planning Obligations Manager – Bristol City Council)

part or our part Less than 12 of the reviews have related to genuine points of principle or disagreement 2 CIL appeals in the past three years – both successfully defended Place CIL Implementation /Neighbourhood Committee, which is made up of the elected ward members Place CIL Implementation – Neighbourhood Development Plans Four Neighbourhood Development Plans being brought forward in Bristol None of them follow ward boundaries Place CIL Implementation – Neighbourhood Development Plans Neighbourhood/


Articulating Accessibility In Place- Based Community Organizations Joint World Conference on Social Work, Education and Social Development June 28-30,

of British Columbia School of Social Work NHiMV Project First systematic study of NHs in Canada Four years, collaborative, funded by SSHRC Research questions: –“How do neighbourhood houses, as place-based, multi-service, community-governed, non-profit organizations, affect social equity, collective/ access to other parts of the net, so it’s a network Accessing through referrals –so we can refer our participants to a summer program that takes things around, a mother goose that Templeton pool or whatever. … I/


Parish meeting April 23 rd Discussion of planning applications – WYE2 in detail Traffic analysis for the Neighbourhood Plan The new Our Place Wye project.

Parish meeting April 23 rd Discussion of planning applications – WYE2 in detail Traffic analysis for the Neighbourhood Plan The new Our Place Wye project Planning applications for WYE1 and WYE2 challenge the principles agreed for the Neighbourhood Plan Applications Go against the principles agreed at workshops Conflict with the agreed outlines for village design Fail to include innovative proposals to improve the village boundaries Overlook problems/


Young stars in the nearest solar neighbourhood Oct 24, 2001 The Gould Belt and other large star forming complexes 1 Young stars in the nearest solar neighbourhood.

(~ 3-4 M  )  May more massive stars be exploded as SNe in the last few Myr?  In this way some explosions would took place in a nearly central region of the LB  This could be a more realistic description of the present spatial geometry of the LB Young stars in the nearest solar neighbourhood Oct 24, 2001 The Gould Belt and other large star forming complexes/


Interested in Neighbourhood Planning in Cotswold District?

neighbourhood planning. They have long experience of working with and representing local communities. In areas without a parish or town council, local people will need to decide which organisation should lead on coordinating the local debate. In some places, existing community groups may want to put themselves forward. In other places/receive notification of future LDF consultations and newsletter updates, please register on our consultation portal http://consult.cotswold.gov.uk/portal or email: ldf@cotswold/


COMPETING IDEAS OF SOCIAL JUSTICE AND SPACE Locating Critiques of Housing Renewal in Theory and Practice Ed Ferrari, University of Sheffield 2012 HSA conference.

, SHMAs Strategic multi-area partnerships, HMR Pathfinder boards Place Housing and neighbourhood design codes, ‘place making’ arguments Refurbishment, ‘housing as being’ arguments, demolition of housing in poor condition, heritage arguments from within Representations of place and identity; histories of scale, ‘heritage’ arguments from afar Neighbourhood/ multi-agency partnerships; ‘place marketing’ or ‘branding’ arguments; Neighbourhood Renewal Scale City-regional economic development strategies, economic/


Www.wecnf.org WEST EALING CENTRE W13 _____________________________________________________________ NEIGHBOURHOOD FORUM.

Budget A Project Plan Delivered its first leaflet to all publicly accessible homes and businesses in the area WECNF Support West Ealing Neighbours (WEN) West Ealing Traders Association (WETA) Central & Local Government Officers Elthorne & Walpole Ward Forums Ealing Centre Neighbourhood Forum Hanwell Community Forum WECNF what next? Elect our first 12 person Management Committee – members from business (4), Community (4) and residents (4/


#neighbourhoodplanning THE WHAT and THE HOW. 3… The number of neighbourhood plans.

A PLAN First Golden Rule PLAN POSITIVELY NPPF Planning must be a creative exercise in finding ways to enhance and improve the places in which we live our lives… Neighbourhoods should plan positively to support local development, shaping and directing development in their area… Neighbourhood plans should not promote less development than set out in the Local Plan… Thame VISION Thame must maintain its character as a real/


‘Snakes and Ladders: Understanding Young People’s Transitions to Adulthood in contexts of poverty and disadvantage’ Professor Tracy Shildrick

lives  Ill-health & caring responsibilities impacted on well-being as well as on labour market engagement Strengths of ‘poor places’  ‘Living here, it’s brilliant….If you’re stuck, someone’ll help you’ (Martin, 20).  ‘/and well-being) Conclusions: what has happened here?  Teesside, these neighbourhoods, built for industry - & industrial workers & families; success, security, prosperity  But our interviewees born on the cusp/ in the depths of accelerated global- local economic change (between 1974 & /


Embedding Landscape in your Neighbourhood Plan How to create a local landscape character assessment.

Neighbourhood Plan. Creates strong evidence base for Neighbourhood Plan. Clear expression of how community sits in its wider, but local, environmental setting Clear expression of how community sits in/of different components which provide a sense of place to our surroundings. It is not just about visual perception….Landscape character is/Authority should have in place a Landscape Character Assessment –- starting place Local Authority should have in place a Landscape Character Assessment –- starting place Example Map shows/


“Putting people and place before the movement of motor vehicles”….. unlocking… “the full potential of our streets to become vibrant, safe and attractive.

“the full potential of our streets to become vibrant, safe and attractive places.” John Swinney Foreword to / Integrate street design RCC Granted Resolve technical details Planning and RCC in parallel STREET STRUCTURE STREET LAYOUT Traffic Generation Street Use: Pedestrians Cyclists/STRUCTURE Pedestrians and cyclists Connections to wider networks Connections within a place Block Structure Walkable neighbourhoods Public transport Context and character Orientation STREET LAYOUT Achieving appropriate traffic/


The Impact of Gentrification in Toronto’s “Little Portugal” - Canada Carlos Teixeira University of British Columbia – Okanagan Campus and Metropolis Canada.

aging population is more incentives for them to take care of their own homes…aging in place is a good way to go. Also there is an urgent need in our community for more housing for seniors…Some of them do not need any type of /my knowledge the demand is there but the need has not been filled.” Conclusion In general, all of the Portuguese respondents in this study agreed that “Little Portugal” is a neighbourhood in transition. There was also a general consensus that the population most impacted by the/


1. Neighbourhood Plan Village Meeting March 1 st 2014 2.

Our Village Why do we need a Neighbourhood Plan? Because South Northants Council think about the County, not just Kislingbury Local Plans set out the broad strategy for development in your area. They cannot tell you exactly what changes will happen in each neighbourhood. Local Plans can: Identify where development should take place/you want South Northants Council to use the Neighbourhood Plan for Kislingbury Parish to help it decide planning applications in the neighbourhood area? 21 22 The High Street 23 /


In Danger.. Me neighbourhood is peaceful It`s perfect place to rest It`s easy to relax here When you`re feeling tired or stressed My neighbourhood is.

-Listen to Alex describing his neighbourhood. - What is it like? -What shops are there? Answer the following questions: - Have you got any pets in your neighbourhood? - Do you enjoy living in the Republic of Mari El? - Do you like the wildlife in our republic? Read and translate into /pressed their heads to her stomach and draw legs and their tails. Hedgehogs live in a place with a layer of leaves and twigs. Hedgehogs is not enough places where they can live. Many hedgehogs die under the wheels of сars. Semi/


A Clean Sweep Delivering cleaner streets in diverse neighbourhoods Nigel Tyrrell London Borough of Lewisham.

Need to avoid a ‘leveling down’ Should we aim to be in the middle, therefore? How does neighbourhood context affect outcomes? Physical environment: - Flats and non-traditional forms /in prominent places to show that he is around and tries to work “in ways to keep people happy”, which include doing “extras” (unpaid). NB Recall the lack of ‘A’s in/.a. – Lower than the Council ‘office worker average’ Key element of our approach to efficiency Everyone on-board Love Lewisham, staff & community engagement Community/


SHERINGTON NEIGHBOURHOOD PLAN 1.1 Milton Keynes Council – Community Involvement Explanation.

funded by a grant. Research is currently in progress to ascertain the costs incurred by other areas, so that we have a more reliable estimate for our own budgeting purposes. SHERINGTON NEIGHBOURHOOD PLAN 2.3 Neighbourhood Plan – FAQ www.sherington.org.uk//it is hoped to shorten this period. However, the need for extensive consultations, some of which have a statutory time period, places constraints on this. Who takes part? You do. The WHOLE community is involved and WILL be consulted - residents, landowners,/


Ads by Google