Ppt on chromosomes and genes model

Exploratory Failure Time Analysis and Copy Number Variation Inference Cheng Department of Biostatistics St. Jude Children’s Research Hospital.

-Gray hazard rate regression model Censor at time competing event: OK for testing stochastic independence, biased for estimation Animal CellAnimal Cell Organelles Nucleus Nucleolus Endoplasmic Reticulum Centriole Centrosome Golgi Cytoskeleton Cytosol Mitochondrion Secretory Vesicle Lysosome Peroxisome Vacuole Nucleus Functions The cell nucleus is an organelle that forms the package for our genes and their controlling factors. Store genes on chromosomes Organize genes into chromosomes to allow cell/


DNA and Chromosomes 4TH Edition Chapter 4. DNA and Chromosomes

regulator proteins Telomere-bound Sir protein complex recognizes underacetylated N-terminal tails of selected histones Responsible for the silencing of genes located near telomeres. Figure 4-47. Speculative model for the heterochromatin at the ends of yeast chromosomes. (A) Heterochromatin is generally underacetylated, and underacetylated tails of histone H4 are proposed to interact with a complex of Sir proteins, thus stabilizing the association of/


European Academy Bozen/Bolzano EURAC Dec 16, 2005

may support linkage under an appropriate genetic model Linkage analysis of complex diseases Thus, classical linkage analysis can be used to map genes involved in the etiology of complex diseases; however: The genetic model must be specified correctly, otherwise spurious/ Over time the association between the new mutation and linked mutations will decay by recombination . Decay of LD over generations A mutation has occurred in the gene of the ancestral chromosome, and this has spread in the population In a /


dsDNA כיווניות קשר פוספו A:T and G:C  = 10 -10.

3D Zigzag model of the 30-nm chromatin fiber מנוקלאוזום לסלנואיד solenoid פיגום מבנה הכרומוזום מבנה הכרומוזום בשלב המטפזי אופן אריזת הDNA בתא: מהנוקלאוזום לכרומוזום. Histon assembly movie DNA to chromatin מבנה של כרומוזום במיקרוסקופ אלקטרוני 4 Penicillin mold 46Human 32Yeast42Macaque 40Mouse 38Cat 48Potato26Frog 20Algae16Planaria 20Corn8Fruit fly Species Total number of chromosomes/somatic (body) cell Dog 78 There is no connection between the number of chromosomes and the genome size, gene content, or/


Microbial Genetics Mutation Genetic Recombination Model organism

Gene Maps Interrupted Matings E. coli Chromosome 4,639,221 Base Pairs 4,288 Open Reading Frames 88% ORF 1% rRNA, tRNA 10% Promoter, Origin, etc 6% Operons Lateral Gene Transfer Horizontal Gene transfer Pathogenicity Islands ICE – Integrative and/ Mutations Point Mutation Base-Pair Substitution Silent, Missense, Nonsense Mutations Mutation Genetic Recombination Microbial Models Molecular Cloning Biotechnology Mutants Genetic Word List 2 Temperature Sensitive Mutation Reading Frame Frame Shift Mutation/


Unit 3: Molecular Genetics Chapter 5: The Structure and Function of DNA.

have been made to the structure of DNA since Watson and Crick first proposed the model, many features remain the same Important Features of DNA Structure/genes on each chromosome can differ as well  Genes are not evenly spaced along a chromosomeGenes are not equally divided among chromosomes  Ex: In humans, chromosome 19 has 72 million bas pairs and about 1450 genes while chromosome 4 has almost 1.3 billion base pairs but only 200 genes Variation in the Eukaryotic Genome  The size and number of genes/


Welcome to Biotechnology! August 26 th, 2013 Grab one of each of the following and put your name on it:  1. file folder  2. student information card.

protein production by manipulating DNA and RNA codes. Moving genes into cells to produce new proteins is the basic principle in genetic engineering. 2. What do lysosomes do? A lysosome is a membrane-bound organelle that is responsible for the breakdown of cellular waste. Biotech Agenda December 3 rd, 2013  We will create a model of DNA using paper and colored markers or pencils/


Lecture 3 what Genes are and What they do Part II Three Chapters.

model of meiotic recombination Homologs physically break, exchange parts, and rejoin. Breakage and repair create reciprocal products of recombination Recombination events can occur anywhere along the DNA molecule Precision in the exchange prevents mutations from occurring during the process Gene conversion can give rise to unequal yield of two different alleles. 50% of gene conversions are associated with crossing over of adjacent chromosomal regions, and 50% of gene/


GENETICS AND HEREDITY. A trait is a notable feature or quality in a person. Each of us has a different combination of traits that make us unique. Traits.

genes are dominant and other ones are recessive. Dominant genes hide other genes that are present, and the trait corresponding to that gene will appear. Traits represented by recessive genes will only appear when the dominant gene is not present. Genes contain information about a specific characteristic or trait and can either be dominant or recessive. Genes are found on chromosomes/eyes GENOTYPES AND PHENOTYPES TRAITDAD’S ALLELE MOM’S ALLELE COIN TOSS RESULTS NEW MODEL BABY GENOTYPE NEW MODEL BABY PHENOTYPE/


Genes and Isochores: A Game of Chicken? William H. Press UT Austin Harlan Robins Fred Hutchinson Cancer Research Center.

same as “realized” (e.g., by mutations) use 4-component Gaussian mixture model to find the proportions: plug into a model for correlated and independent fractions: solving for the model parameters gives: Simplest hypothesis, marking and realizing in same epoch, has problems with phylogeny isochores? yes NO! 40% of genes marked and realized here? “marking” = chromosome ends “realizing” = start biased mutation Also (preliminary), we can rule this out/


[III] Genes, Genomics, and Chromosomes Eukaryotic gene structure, Cot analysis, Rot analyses, chromosomal organization of genes and noncoding DNA Genomics:

stabilizing the transcription factor complex to regulate the expression of genes DNA binding transcription factors: Regulate the transcription of genes Model for the Folding of the 30- nm Chromatin Fiber in a Metaphase Chromosome Model for the Packing of Chromatin and the Chromosome Scaffold in Metaphase Overview of the Structure of Genes & Chromosomes Eukaryotic Chromosomes Contain One Linear DNA Molecule Since the largest intact DNA molecules in lower eukaryotes can/


Mutations and Genetic Modifications TEKS BIO 6C. Instructions---READ EVERYTHING Today, you will learn about MUTATIONS. Follow the powerpoint, watching.

slide. Color the “translocation” section on your “modeling chromosomal mutations” page, answer the question that follows, then cut and glue both onto your slide. Duplications Occurs during crossing over and one chromosome ends up with more genes than it received. Occurs during crossing over and one chromosome ends up with more genes than it received. Color the “duplication” section on your “modeling chromosomal mutations” page, answer the question that follows, then/


Do Now  Why is it important to learn about DNA and how can DNA be used to help people?  NUA Notebook Check Today  Why is it important to learn about.

rules  Each strand of the double helix serves as a template, or model, for the new strand  During DNA replication, the DNA molecule separates/)  Using the genetic code given, separate the two original strands and create two molecules of DNA. Use the base pairing rules. (hint/ Gene mutations are changes in a single geneChromosomal mutations are changes in the whole chromosomeGene mutations are changes in a single geneChromosomal mutations are changes in the whole chromosome Gene Mutations/


CAMPBELL BIOLOGY IN FOCUS © 2014 Pearson Education, Inc. Urry Cain Wasserman Minorsky Jackson Reece Lecture Presentations by Kathleen Fitzpatrick and Nicole.

Material: Scientific Inquiry  When T. H. Morgan’s group showed that genes are located on chromosomes, the two components of chromosomes—DNA and protein—became candidates for the genetic material  The key factor in determining /and one newly made strand  Competing models were the conservative model (the two parent strands rejoin) and the dispersive model (each strand is a mix of old and new) © 2014 Pearson Education, Inc. Figure 13.10 (a) Conservative model (b) Semiconservative model (c) Dispersive model/


Forensics and Probability. Origin of Variation? Charles Darwin from, On the Origin of Species by Means of Natural Selection, 1859 "...no-one can say.

pattern he observed in F 2 offspring Four related concepts make up this model These concepts can be related to what we now know about genes and chromosomes Alternative versions of genes account for variations in inherited characters For example, the gene for flower color in pea plants exists in two versions, one for purple flowers and the other for white flowers These alternative versions of a/


Life Span Development Theories of Development – Ch. 2 Heredity and Environment – Ch. 3 June 10, 2004 Class #2.

genes Culture counts too (whether alcohol is present in environment) Culture counts too (whether alcohol is present in environment) Here we notice disruptions of normal development Here we notice disruptions of normal development origins of genetic and chromosomal abnormalities origins of genetic and chromosomal abnormalities misinformation and prejudice add to problems of people with these abnormalities misinformation and prejudice add to problems of people with these abnormalities Chromosomal and/


The Evolution of a Heterochromatic Domain in Drosophila: Investigating the Strange Dot Chromosome Sarah C R Elgin January 2012.

.] Model for spreading of heterochromatin Establishing silencing: a multi-step process w m4 reporter (screens by Reuter, Grigliatti, others) Loss of euchromatin marksGain of heterochromatin marks Heterochromatin formation on the dot chromosome… The fourth chromosome appears heterochromatic but has ~80 genes: -- do these genes have unusual characteristics? -- how has the chromosome evolved? - how do these genes function? 2 The Drosophila melanogaster fourth chromosome exhibits an amalgam of euchromatic and/


Human Gene Mapping & Disease Gene Identification.

risk for disease in themselves or their offspring, ◦ development of cell and animal models, ◦ drug therapy to prevent or ameliorate disease or to slow its progression, and ◦ treatment by gene replacement The effect of recombination on the origin of various portions of a chromosome. Because of crossing over in meiosis, the copy of the chromosome the boy (generation III) inherited from his mother is a mosaic/


Chapter11 DNA Replication and Synthesis Semiconservative replication of DNA makes genetics continuity between parental and progeny cells possible, as predicted.

or bacterial chromosomes or eukaryotic homologs during Genetic exchange at equivalent positions along two chromosomes with substantial DNA sequence homology is referred to as general or homoloeous recombination. Several models attempt to explain crossing over, and they all /which genetic exchange also occurred. Similar findings are apparent in the study of other fungi as well. Gene conversion is now considered to be a consequence of the recombination process. One possible explanation interprets conversion /


The eukaryotic chromosome (Chapter 16) Friday, November 5, 2010 Genomics 260.605.01 J. Pevsner

to the transcription start site. The model is as follows: The specificity is good (~70%), and the positional accuracy is excellent. The program identifies ~50% of TSSs—although it does not always know the direction of transcription. Outline: eukaryotic chromosomes General features of eukaryotic chromosomes Repetitive DNA content of eukaryotic genomes Gene content of eukaryotic chromosomes Regulatory regions of eukaryotic chromosomes Comparison of eukaryotic DNA Variation in/


Sex = Sum total of those differences in structure and function on the basis of which an organism is classified as male or female. Theories of sex determination:

within a very small segment of the Y chromosome by Page and co-workers in 1987.  However, the presence of a similar gene, ZFX, on the X chromosome prompted the propounding of the dosage compensation / X-inactivation theory of sex determination. Genetic dosage compensation / X-inactivation model of sex determination, contd.  According to this theory, both ZFX and ZFY produced functionally interchangeable proteins.  It therefore follows/


Chapter 16- end REVIEW. Fig. 16-7 (c) Space-filling model Hydrogen bond 3 end 5 end 3.4 nm 0.34 nm 3 end 5 end (b) Partial chemical structure (a) Key.

an exon being duplicated on one chromosome and deleted from the homologous chromosome In exon shuffling, errors in meiotic recombination lead to some mixing and matching of exons, either within a gene or between two nonallelic genes Darwin ’ s Focus on Adaptation / change The punctuated equilibrium model contrasts with a model of gradual change in a species’ existence Fig. 24-17 (a) Punctuated pattern (b) Gradual pattern Time CH 25 ORIGIN OF LIFE Protobionts Replication and metabolism are key properties /


Chapter 2 Lecture Notes and Behavior Genetics. Meiosis Meiosis: This is division of the germ cells (i.e., the male or female reproductive cells) The result.

are superior to either homozygous condition. Heterozygous genes: Sickle Cell Chromosomal Abnormalities Down Syndrome Sex-Chromosome Anomalies: Turner Syndrome (XO pattern) Triple-X/AND NP Interactions between Genes and Environments: Gottlieb’s model Interactions between Genes and Environments Interactions between genes and environments modeled by Gottliebs bi-directional model. Note that the environmental effects on the genes refer to turning the genes on or off, not to actually modifying the genes/


Griffith and Transformation  In 1928, British scientist Frederick Griffith wanted to learn how certain types of bacteria produce pneumonia.  He isolated.

of base pairing.  Each strand of the double helix of DNA serves as a template, or model, for the new strand. How Replication Occurs  The enzymes “unzip” a molecule of DNA.  The unzipping occurs /its normal functions. Chromosomal Mutations  A chromosomal mutation involves changes in the number or structure of chromosomes.  Chromosomal mutations may change the locations of genes on chromosomes and even the number of copies of some genes.  Figure 12-20 shows four types of chromosomal mutations. A deletion/


GENETIC ALGORITHM A biologically inspired model of intelligence and the principles of biological evolution are applied to find solutions to difficult problems.

Representation of Solutions: The Chromosome Chromosomes have either binary or real valued genes In binary coded chromosomes, every gene has two alleles In real coded chromosomes, a gene can be assigned any value from a domain of values Model Learning Use GA to learn/ of fitness within a population. If there is a lot of fitness difference between the more fit and less fit chromosomes, then the selective pressure will be higher Disadvantage As the population converges upon a solution, the selective/


1.Biosphere Land – water – atmosphere (inhabited by life). 2. Ecosystem Living thing and non-living thing with which life interacts in particular area.

If the two alleles differ, one of them will be Dominant, and the other is Recessive. Red colour gene ( allele ) allele White colour gene ( allele ) Homologous chromosomes A Punnett square analysis of the flower-color example demonstrates Mendel’s model.A Punnett square analysis of the flower-color example demonstrates Mendel’s model. Mendel’s model accounts for the 3:1 ratio in the F 2 generationMendel/


Finding Genes in a New Fly Genome: Teaching about Genes/Genomes via Bioinformatics Research Sarah Elgin, Anya Goodman, Wilson Leung Eric Tsoi, Charlene.

. mojavensis dot chromosome Students completed 68 projects covering 1.7 Mb closing 26/28 gaps, adding ~15,000 bp and improving ~5000 bp. Each project finished and annotated (all isoforms) twice; reconciliation for quality control done at Wash U Fosmid sequence matches consensus sequence Putative polymorphisms Finished sequences submitted to Genbank, annotations to Flybase. Annotation: Create gene models using sequence homology and computational predictions Gene Predictions Sequence/


7 th & 8 th Period Review Projects 2015. LO 3.26: The student is able to explain the connection between genetic variations in organisms and phenotypic.

representations and models to analyze situations or solve problems qualitatively or quantitatively. Explanation: The student should be able to know the mechanisms of gene regulation based on a representation given. For genes to be silenced, there must be something that hinders their transcription so then that gene cannot be translated into a protein. One mechanism of gene regulation is the modification of the histones in a chromosome/


Genetic disorders and modes of inheritance. Genetic disorders Gene alterations can be cateogorized further into: Monogenic They are caused by a single.

Why do symptoms develop in some persons with a fragile X chromosome and not in others? The answer seems to lie in the number of CGG repeats in the FMR-1 gene Humans normally show a considerable variation in the number of CGG repeats/frequency of the disease increases in the general population A lower threshold results in a smaller difference Considerations of the Threshold model The risk increases with the severity of the malformation or disease in cleft lip/palate: proportion of affected first-degree/


CAMPBELL BIOLOGY IN FOCUS © 2014 Pearson Education, Inc. Urry Cain Wasserman Minorsky Jackson Reece Lecture Presentations by Kathleen Fitzpatrick and Nicole.

Material: Scientific Inquiry  When T. H. Morgan’s group showed that genes are located on chromosomes, the two components of chromosomes—DNA and protein—became candidates for the genetic material  The key factor in determining /and one newly made strand  Competing models were the conservative model (the two parent strands rejoin) and the dispersive model (each strand is a mix of old and new) © 2014 Pearson Education, Inc. Figure 13.10 (a) Conservative model (b) Semiconservative model (c) Dispersive model/


Identifying conserved spatial patterns in genomes Rose Hoberman Dannie Durand Depts. of Biological Sciences and Computer Science, CMU David Sankoff Dept.

that clusters indicate common ancestry...statistics...modeling...algorithms 76 These are criteria…. Size and density Hard to capture One I’ve chosen is widely use, but see at end of talk has some problems 77 Genome The complete set of genetic material of an organism or species Chromosome A double-stranded molecule of DNA GGGGCGGGGGGCGGGGGGGGGAGCAGAAGTCTGGGAATCGATCTGGAAATCCTCCTAATTTTTACTCCCTCTCCCCG CCCCGCCCCCCGCCCCCCCCCTCGTCTTCAGACCCTTAGCTAGACCTTTAGGAGGATTAAAAATGAGGGAGAGGGGC Gene A protein coding sequence 78/


CAMPBELL BIOLOGY IN FOCUS © 2014 Pearson Education, Inc. Urry Cain Wasserman Minorsky Jackson Reece Lecture Presentations by Kathleen Fitzpatrick and Nicole.

Material: Scientific Inquiry  When T. H. Morgan’s group showed that genes are located on chromosomes, the two components of chromosomes—DNA and protein—became candidates for the genetic material  The key factor in determining /and one newly made strand  Competing models were the conservative model (the two parent strands rejoin) and the dispersive model (each strand is a mix of old and new) © 2014 Pearson Education, Inc. Figure 13.10 (a) Conservative model (b) Semiconservative model (c) Dispersive model/


1 Recombination and Mapping (cont’d). 2 Factors affecting MU In most cases the order of genes revealed by mapping techniques correspond to the order of.

a chromosome The tenets of the model are 1Genes are fundamental units of function Parts of a gene cannot function 2Genes are fundamental units of mutation The gene changes as a whole from one form to another 3Genes are fundamental units of structure The gene is indivisible by recombination We will go through experiments that show that recombination does occur within a gene 12 Recombination and genes If/


Lesson Overview 12.1 Identifying the Substance of Genes.

Identifying the Substance of Genes Base Pairing Watson and Crick’s model showed that hydrogen bonds /Genes Chromosomal Mutations Chromosomal mutations involve changes in the number or structure of chromosomes. These mutations can change the location of genes on chromosomes and can even change the number of copies of some genes. There are four types of chromosomal mutations: deletion, duplication, inversion, and translocation. Lesson Overview Lesson Overview Identifying the Substance of Genes Chromosomal/


Chapter 15: The Chromosomal Basis of Inheritance Students ½ Learning log – due Tuesday (10/6) Genetics Problems – both chapters – due 10/15 Cell phones.

patterns that cannot be explained by Mendel’s model of the inheritance of traits. Chapter 15: The Chromosomal Basis of Inheritance 1.How was it determined that chromosomes carry genes? -Thomas Hunt Morgan -1 st to trace a specific gene to a specific chromosome -Noticed a fly with white eyes (/ with a male of normal phenotype, there is a 50% chance that each daughter will be a carrier like her mother, and a 50% chance that each son will have the disorder. If a carrier mates with a male who has the disorder, /


 Unit 7: Growth, Development, & Reproduction Asexual Reproduction, Sexual Reproduction, and Genetics.

Cytosine  A only matches T  C only matches G  A gene is a section of base pairs Snow Days  Friday, February 12, 2016/and III of Multiplicity activity Multiplicity: Modeling the Cell Cycle  Part III: Modeling The Cell Cycle  Follow Ms. Braman’s model of the cell cycle using paper chromosomes and string (in the envelopes).  Each envelope should contain:  2 yellow centrioles  2 pink chromosomes  2 blue chromosomes  2 orange chromosomes  2 purple chromosomes  2 strings Multiplicity: Modeling/


What to know… Content: Difference between a chromosome, gene, allele, and locus Genotype vs phenotype Dominant vs recessive alleles Homozygous vs heterozygous.

chromosome, gene, allele, and locus Genotype vs phenotype Dominant vs recessive alleles Homozygous vs heterozygous Mendel’s Laws of heredity (1 st and 2 nd ) Why the Pea Plant was a good model organism Current model organisms Incomplete dominance Co-dominance What to know… Skills: use a Punnett square to predict genotypes and phenotypes of offspring. (monohybrid and/ peas F 2 generation YyRr What’s going on here? If genes are on different chromosomes… – how do they assort in the gametes? – together or/


The nuclear envelope and traffic Internal organization of the nucleus The nucleolus The nucleus during mitosis The Nucleus between the nucleus and cytoplasm.

chromatin appears to be uniformly distributed, the chromosomes are actually arranged in an organized fashion and divided into discrete functional domains that play an important role in regulating gene expression. 1885 就有人發現, each chromosomes occupies a distinct territory, with centromeres and telomeres attached to opposite sides of the nuclear envelope. Figure legend: A model of the nucleus, showing the five chromosome arms in different colors. The positions of/


Inheritance &Variation All students will be able to recall the difference between inherited and environmental variation – C Most students will be able.

nucleotide base so the are complimentary. Grade A = Write a paragraph and explain what you have learned about bases, amino acids and making proteins from genes. Use models to support your knowledge. Solutions LO Checkpoint! All students will be able to describe how characteristics are caused by cells making proteins using information from genes in chromosomes. – C Most students will be able to explain that DNA/


© 2011 Pearson Education, Inc. Mendel and the Gene Idea.

parents results in offspring that are ¼ RR, ½ Rr, and ¼ rr, which produces a 3:1 ratio of “phenotypes”. © 2011 Pearson Education, Inc. Testing the Model Mendels genetic model—a set of hypotheses that explains how a particular trait is / experimental results with Stevens’ observations on sex chromosomes, and proposed that the gene for white eye color in fruit flies is located on the X chromosome and that the Y chromosome does not carry an allele of this gene. Morgans hypothesis is called X-linked inheritance/


2 nd Period Review Projects. LO 3.33: The student is able to use representation(s) and appropriate models to describe features of a cell signaling pathway.

to a receptor Introduction of a kinase that is active later in the phosphorylation cascade Which of the following best explains the model to the left? a)Signal amplification is occurring as a response of one cell induces a pathway of another type of/resulting in one daughter cell not having enough or having too many chromosomes. Not enough could be fatal to the cell while having too many would lead to an increase in expression of genes and if they promote growth the cell would grow uncontrollably, leading to/


© 2013 Pearson Education, Inc. Lectures by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential.

genes. Two sister chromatids are joined together tightly at a narrow “waist” called the centromere. Eukaryotic Chromosomes © 2013 Pearson Education, Inc. When the cell divides, the sister chromatids of a duplicated chromosome separate from each other. Once separated, each chromatid is –considered a full-fledged chromosome and –identical to the original chromosome. Eukaryotic Chromosomes/ Education, Inc. Figure 10.3a James Watson (left) and Francis Crick The model of DNA is like a rope ladder twisted into a /


Outline of Talk Protein Genes Protein Genes SNPs SNPs Haplotypes Haplotypes Finding a Disease Locus Finding a Disease Locus.

. Now, new genes are predicted computationally using a gene model. Finding Protein Genes Before the sequencing of genomes, protein genes were found experimentally. Now, new genes are predicted computationally using a gene model. Finding Protein Genes Before the sequencing of genomes, protein genes were found experimentally. Now, new genes are predicted computationally using a gene model. Building a Gene Model Gene models for prediction are based on the structure of genes in DNA and their messenger RNAs/


1 Sylvia Richardson Centre for Biostatistics Imperial College, London Bayesian hierarchical modelling of genomic data In collaboration with Natalia Bochkina,

T test with p value < 5% are in red) 46 Part 4 Introduction A fully Bayesian gene expression index Differential expression and array effects Mixture models –Classification for differential expression –Bayesian estimate of False Discovery Rates –CGH arrays: models including information on clones spatial location on chromosome Discussion 47 Mixture and Bayesian estimation of false discovery rates Natalia Bochkina, Philippe Broët Alex Lewin, SR 48/


Science Study Notes 2011 Andrew Newbound © Andrew Newbound 2013.

Formation, history & future of universe Astronomers & Cosmologists Use telescopes + satellites + space probes Computer simulations & models Big Bang Before = nothing Started space, energy & time © Andrew Newbound 2013 The Big Bang Origin of /Determination Sex linked Sex linked genetic diseases Genes found on the X and Y chromosome Y chromosome only has a few genes compared to the X chromosome Sex linked genetic diseases Caused by defective genes on X chromosome and occur more frequently in males than females/


The Pieces Inside of You that Make You Who You Are

DNA is Fashionable Just like a model wearing a suit jacket with suit pants, or a t-shirt with blue genes, A only pairs with T and G only pairs with C. A T Remembering Key: “AT” G and C look alike G C DNA / bases shifted over one and amino acids changed. Colorblindness Caused my multiple mutations on X chromosome. Males have one X chromosome and one Y chromosome. Females have two X chromosomes. When genes on one chromosome do not code correctly, the body naturally goes to the other chromosome to see if it /


GENE REGULATION IN BACTERIA AND BACTERIOPHAGES

apart in the DNA causing a loop to form in the DNA. As a result expression of the lac operon is turned off. This model also shows the CAP protein (dark blue) binding to the CAP site in the promoter (dark blue DNA). The -10 & -35 / Bacteria that get F’ have 2 copies of lacI gene merodipoloids PaJaMo Experiment 2 lacI genes in a merodiploid are alleles lacI– on the chromosome lacI+ on the F’ factor Genes on F’ plasmid are trans to bacterial chromosome If hypothesis 1 is correct repressor produced from F’ /


Genetics: From Genes to Genomes

H2A, H2B, H3, and H4 Core histones (H2A, H2B, H3, and H4) make up the nucleosome Posttranslational modifications of histones H3 and H4 Methylation and acetylation of histone tails Affect chromatin structure and gene expression in specific chromosomal regions Copyright © The McGraw/ McGraw-Hill Companies, Inc. Permission required to reproduce or display Hartwell et al., 4th edition, Chapter 12 Models of higher-order packaging 100 Å fiber is compacted into 300 Å fiber by supercoiling Results in an additional /


DNA, RNA, and Proteins.

and Proteins Section 1: The Structure of DNA Preview DNA: The Genetic Material Searching for the Genetic Material The Shape of DNA The Information in DNA Discovering DNA’s Structure Summary DNA: The Genetic Material The instructions for inherited traits are called genes. A gene is a small segment of deoxyribonucleic acid, or DNA, that is located in a chromosome/Watson and Crick used both Chargaff’s data and the X-ray diffraction studies to create a complete three-dimensional model of DNA. Their model showed /


Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 6-1 Powerpoint to accompany Genetics: From Genes to Genomes Third.

replication – three possible models Semiconservative replication – Watson and Crick model Semiconservative replication – Watson and Crick model Conservative replication: The parental/gene conversions are associated with crossing over of adjacent chromosomal regions, and 50% of gene conversions are not associated with crossing over. Gene conversion can give rise to unequal yield of two different alleles. 50% of gene conversions are associated with crossing over of adjacent chromosomal regions, and 50% of gene/


Ads by Google