2. Today… Turn in Bozeman homework Complete DNA modeling activity Lecture notes on Transcription & Translation POGIL Homework assigned: read article from website (your choice) and post a short summary. Respond to 1 other person’s post with a comment or question. Due Sunday by 11:59pm.

3. From Gene to Protein Chapter 17 - Campbell

4. What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

5. The “Central Dogma” Flow of genetic information in a cell – How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait

6. RNA Monomers = nucleotides Phosphate Ribose sugar Nitrogen Bases – uracil instead of thymine U bonds with A C bonds with G single stranded RNADNA transcription

7. Compare DNA and RNA DNARNA ShapeDouble helix 2 strands Single strand SugarDeoxyriboseRibose BasesA, T, C, and GA, U, C and G LocationOnly in the nucleus Allowed to travel from nucleus to cytoplasm

8. Types of RNA Ribosomal RNA (rRNA) – Major component of ribosomes Transfer RNA (tRNA) – Folded upon itself – Carries the amino acids to the mRNA Messenger RNA (mRNA) – Sequence of nucleotides that determines the primary sequence of the polypeptide – Made in the nucleus from the DNA: transcription snRNA (small-nuclear “snurps”) – Forms the “spliceosomes” which are used to cut out introns from pre-mRNA siRNA (small-interfering) – targets specific mRNA and prohibits it from being expressed

9. mRNA Protein Synthesis: From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a a a protein translation ribosome trait

10. Which gene is read on the DNA? Promoter region – binding site before beginning of gene – Generally referred to as a TATA box because it is a repeating sequence of T and A – binding site for RNA polymerase & transcription factors Enhancer region – binding site far upstream of gene Speeds up process

11. Transcription Factors – transcription factors bind to promoter region of DNA proteins can be activated by hormones (cell signaling) turn on or off transcription – triggers the binding of RNA polymerase to DNA

12. Transcription: DNA to mRNA Takes place in the nucleus A section of DNA is unzipped RNA polymerase lays down nucleotides 5’ to 3’ direction. (Does this sound familiar??) The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm

13. Coding strand = “sense strand”. This strand will have the same sequence as the mRNA, and there for the codons Template strand = “anti-sense strand” This is the strand that RNA Polymerase II uses to generate the mRNA. It contains the anti-codons.

14. Eukaryotic Genes Have Untranscribed Regions mRNA must be modified before it leaves the nucleus – exons = the real gene expressed / coding DNA – introns = non-coded section in-between sequence Spliceosomes cut out introns with ribozymes (or are they ribozymes?!) In any case, they are super cool & super complex! 150+ proteins, 5 snRNAs) eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

15. Alternative splicing A single gene can code for multiple proteins. Particular exons of a gene may be included within or excluded from the final, processed messenger RNA (mRNA) produced from that gene. Intron presence can determine which exons stay or go Increases efficiency and flexibility of cell snRNA’s have big role in alternative splicing Starting to get hard to define a gene!

16. A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s Final mRNA processing… Need to protect mRNA on its trip from nucleus to cytoplasm (enzymes in cytoplasm attack mRNA) protect the ends of the molecule add 5 GTP cap add poly-A tail – longer tail, mRNA lasts longer

17. AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit transcriptional unit (gene) TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' exons enhancer 1000 + b

18. Genetic Code Genetic code is based on sets of 3 nucleotides …called CODONS! – Read from the mRNA – 64 different possible combinations exist Only 20 amino acids commonly exist in the human body – Some codons code for the same amino acids (degenerate or redundant) Sequence of codons determines the sequence of the polypeptide Code is “almost” universal…same for all organisms (evolutionary heritage)

19. The Code You don’t need to memorize the codons (except for AUG) Start codon  AUG  methionine Stop codons  UGA, UAA, UAG

20. AUGCGUGUAAAUGCAUGCGCC mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA mRNA MetArgValAsnAlaCysAla protein ? codon

21. How is the code “translated?” Process of reading mRNA and creating a protein chain from the code.

22. Ribosomes: Site of Protein Synthesis Facilitate coupling of tRNA anticodon to mRNA codon Structure – ribosomal RNA (rRNA) & proteins – 2 subunits large small EP A

23. Ribosomes: 3 binding sites Met 5' U U A C A G A site (aminoacyl-tRNA site) – holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) – holds tRNA carrying growing polypeptide chain E site (exit site) – Empty tRNA leaves ribosome from exit site

24. Transfer RNA Found in cytoplasm Carries amino acids to ribosome Contains an “anticodon” of nitrogen bases Anticodons use complementary bond with codons Less tRNA’s than codons, so one tRNA may bind with more than one codon. Supports the degenerate code “Wobble” hypothesis: anticodon with U in third position can bind to A or G

25. Translation: mRNA to Protein In the cytoplasm ribosomes attach to the mRNA – Ribosome covers 3 codons at a time Initiation - The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA – The two amino acids joined with peptide bond Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations

26. Building a polypeptide Initiation – mRNA, ribosome subunits, initiator tRNA come together Elongation – adding amino acids based on codons Termination – STOP codon = Release factor 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3' Good Overview animation

27. Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit EPA 5' 3' RNA polymerase exon intron tRNA

28. Prokaryote vs. Eukaryote Differences Prokaryotes – DNA in cytoplasm – circular chromosome – naked DNA – no introns – No splicing – Promoter & terminator sequence – Smaller ribosomes Eukaryotes – DNA in nucleus – linear chromosomes – DNA wound on histone proteins – introns and exons – TATA box promoter – Transcription factors present

29. Transcription & translation are simultaneous in bacteria – Both occur in cytoplasm – no mRNA editing – ribosomes read mRNA as it is being transcribed Protein Synthesis in Prokaryotes