1. The Case of the Crown Jewels: Investigate a Crime Scene Using DNA Restriction Analysis (DNA Fingerprinting)

2. Outline Overview DNA Structure DNA Synthesis Simple Tandem Repeats (STRs) RFLPs Polymerase Chain Reaction (PCR) Restriction Enzymes Gel Electrophoresis DNA Fingerprinting Mitochondrial DNA CODIS Collection and Preservation of DNA Evidence

3. DNA- Deoxyribonucleic Acid Codes for an organisms traits. 1985- It was discovered that portions of DNA structure of certain genes are as unique to each individual as fingerprints. DNA Fingerprinting (now also referred to as DNA Profiling or DNA Typing) - process of isolating and reading specific DNA markers that are unique. DNA typing is now a routine procedure in crime labs and the US courts have overwhelmingly admitted DNA evidence and accepted the reliability of this scientific technology. What is DNA?

4. In each nucleus of your 60 trillion cells are 46 chromosomes. Arranged along the chromosomes, like beads on a thread are 23,000 genes. The gene is the basic unit of heredity. It instructs the body cells to make proteins that determine everything from hair color to our susceptibility to disease. A gene is actually composed of DNA specifically designed to carry out a specific body function. DNA was 1st discovered in 1868. In 1952, Watson and Crick developed a model of the structure of DNA that is accepted today.

5. DNA Structure

6. What is DNA made of? Nucleotides: Phosphate group Sugar- Deoxyribose Nitrogen Base Carbon atoms of sugar are numbered

7. Nucleotide 1 Nucleotide 2 Nucleotide 3 Nucleotide 4 one strand of DNA PSPSPSPSPSPSPSPS A G T C Nucleotides are linked in a chain

8. PSPSPSPSPSPSPSPS A G T C PSPSPSPSPSPSPSPS G A C T 5’ 3’ Two strands of DNA Double-stranded DNA Anti-parallel Hydrogen bonds AT or GC pairs

10. (DNA codes for proteins, such as pigments in hair and eyes)

11. The Human Genome Project (HGP) Finished in 2003,was an international scientific research project with the goal of determining the sequence of chemical base pairs which make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and functional standpoint.

14. DNA Synthesis

15. Separate strands DNA Replication AGTCAGAGTCAG TCAGTCTCAGTC ------------ 5 5 3 3 TCAGTCTCAGTC AGTCAGAGTCAG 5 5 3 3 AGTCAGAGTCAG AGTCAGTC ------------ ------------ AGTCAGTC TCAGTCTCAGTC 5 53 3 5 5 3 3 AGTCAGAGTCAG TCAGTCTCAGTC ------------ ------------ AGTCAGAGTCAG TCAGTCTCAGTC 5 53 3 5 53 3 Add correct bases

16. Building a Strand of DNA Process is necessary before the cell can divide. DNA strand untwists Weak hydrogen bonds holding the bases together break through enzyme action. Free floating nucleotides join with a complement nucleotide. Process happens at many places on the chromosome until 2 identical strands of DNA are made. Many enzymes are involved in the process. For example, DNA polymerase joins all nucleotides together, determined by the original DNA strand. DNA polymerases also “proofread” the growing DNA double helix for mismatched base pairs, which are replaced with correct bases.

18. DNA at Work  DNA directs the production of proteins.  Every three bases in a gene codes for one specific amino acid in the polypeptide chain. Polypeptides are polymers.  Proteins are made of polymers of amino acids (polypeptides). There are 20 different amino acids from which all proteins on earth are made.  The sequence of the amino acids in the polypeptide chain determines the shape and therefore the function of the protein.  Example- hemoglobin- found in our red blood cells and responsible for carrying oxygen to our body cells. Hemoglobin is made of 4 polypeptide chains.  Consider the problem with sickle cell anemia-

22. How do we distinguish one person’s DNA from another?  We do not need to sequence the entire 3 billion base pairs of a person’s DNA to distinguish it from another person’s DNA  Noncoding regions of DNA (junk DNA) contain sequences that are 3-100 bp in length that are repeated at different locations (loci) along the chromosome. For example- CGGCT may be repeated 3 times at a loci; and it may be repeated 9 times at the same loci on a homologous chromosome.  These sequences are called Short Tandem Repeats (STRs) or VNTRs or RFLPs

23. STRs Each person has STRs (3-7 bases in length repeated) that were inherited from mother and father on the homologous chromosomes inherited at birth. (VNTRs are longer repeats also inherited from your parents.) No person has STRs that are identical to those of either parent, you have a combination of your parents STRs. The number of repeats at each loci on chromosome is highly variable in the population. The length of the DNA after cutting the chromosome with a restriction enzyme, and its position after electrophoresis will depend on the exact number of repeats at the locus

24. The uniqueness of an individual’s STRs provides the scientific marker of identity known as a DNA fingerprint. In the United States the FBI has standardized a set of 13 STR assays (13 different locations on the chromosomes) for DNA typing, and has organized the CODIS database for forensic identification in criminal cases. The United States maintains the largest DNA database in the world: The Combined DNA Index System, contains over 11,592,430 offender1 profiles, 1,325,123 arrestee profiles and 607,173 forensic profiles as of January 2015.

25. Preparation of a DNA fingerprint is a Multi- Stepped Process Specimen collection- blood, semen, etc easy to contaminate a DNA sample with DNA from other sources (bacteria, DNA of person collecting sample) DNA is not stable for very long-it degrades sunlight heat moisture

26. DNA fingerprinting is a comparative process: DNA from crime scene is compared with DNA of a suspect so minimum of two samples must be prepared DNA extraction- standardized methods have been developed need to separate DNA from other cell material and debris from crime scene.

27. RFLP (VNTR or STR) Analysis or PCR

28. Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >5000 cells RFLP / Southern blotPCR Analysis RFLP / Southern blot 3-20 cells

29. RFLP Analysis 1. Not all DNA codes for the making of a protein, much of our DNA seems to have no purpose today. (Maybe it did in our evolutionary past.) 2.Within non-coding segments of DNA are found tandem repeats- sequences of bases that are repeated numerous times. (ex- TAGTAGTAGTAGTAG) 3.30% of the human genome is made up of repeating segments of DNA. 4.These repeating units seem to act as filler or spacers between coding segments.

30. RFLP Analysis All humans have the same type of repeats, but there is tremendous variation in the number of repeats that each of us have. There are numerous possibilities for the number of times a particular sequence of base letters can repeat itself on a DNA strand. The possibilities become greater when one deals with 2 chromosomes each containing different lengths of repeating sequences. Remember that one chromosome in a homologous pair came from your mother and the other one came from your father.

31. Need to Analyze only a Small Fraction of Genome Human genome is too big to analyze: 3 x 10 9 base pairs  65,536 bp between cuts = ~46,000 bands Most regions of genome are not suitable: 99.9% of DNA sequence is same from one person to the next Solutions: Limit analysis to a few genomic regions Focus on regions which are highly variable

32. How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ::::::::::::::::::::::::::::::::::::::::: ATGGCATGGACC :::::::::::: Radioactive probe

34. If you do this for 13 different repeat sequences at 13 different loci on the chromosome, each person produces a different band pattern when the fragments are separated by gel electrophoresis (26 bands will be produced total- 2 bands for each STR analyzed)

36. Since the # of times sequence is repeated is different for each person, fragment size will be different. 13 different STR sequences are analyzed Differences in fragment length occur among individuals at each of the 13 loci on the chromosome where the STRs occur This allows for a lot of variation

37. More on STRs Number of repeats varies greatly between individuals STRs make up 10-15% of the mammalian genome STRs are also called “microsatellites” STRs are “junk DNA” STRs are more stable than VNTRs because they are shorter (3-7 bases in length) STRs are more abundant in our genome than VNTRs so they are more useful

38. Polymerase Chain Reaction (PCR) PCR amplifies the amount of DNA if only a small amount is collected

39. PCR- in a nutshell! Purpose – Quickly make many copies of a region of a DNA molecule, exponentially! Method – Multiple rounds of DNA replication Components in PCR reaction – Target DNA, nucleotides, DNA polymerase, and primers Temperature cycling – DNA replication controlled by temperature…

40. Temperature Cycling in PCR Temperature cycling – PCR process uses a machine (thermocycler) in which PCR reaction goes through ~30 cycles of three different temperature changes: ~95ºC – Melting temperature (Denatures the DNA, breaking the hydrogen bonds between the bases, making the DNA single stranded 50-65ºC – Annealing temperature- ( primer attaches to the single stranded DNA) 72ºC – Extension temperature- ( DNA Polymerase attaches nucleotides)

42. Polymerase Chain Reaction (PCR) analysis 1). primers are designed to flank the region to be amplified in target DNA 2). primers are annealed (attached) to denatured (single stranded DNA) DNA 3). DNA is synthesized using Taq polymerase (from Thermus aquaticus) 4). primers are annealed again and the process is repeated through 20-30 cycles, exponentially amplifying the target sequence 5). DNA is analyzed by gel electrophoresis

43. Conclusion- PCR (Polymerase Chain Reaction) This is a lab technique that enables technologists to copy small quantities or broken pieces of DNA outside of a living cell. 2. DNA polymerases and an automatic machine called a DNA Thermal Cycler are used to copy the DNA once per cycle. 3. Within a few hours 30 cycles can multiply the small quantity of DNA to more than a million pieces of the DNA. 4. Once the DNA has been copied, it can be analyzed. 5. Because of PCR technology, sample size is no longer a limitation in characterizing DNA recovered from crime-scene evidence. In fact, PCR works best with DNA strands that are no longer than a couple of hundred bases. 6. PCR has been applied to the identification of saliva residues found on envelopes, stamps, soda cans, and cigarette butts. 7. With PCR less than one-billionth of a gram of DNA is required for analysis.

44. Restriction Enzymes are used to cut our DNA into segments of different sizes

45. Also called restriction endonucleases Occur naturally in bacteria Hundreds are purified and available commercially Named for bacterial genus, species, strain, and type Example:EcoRI Genus: Escherichia Species: coli Strain: R Restriction Enzymes

46. Recognize specific base sequences in DNA Cut DNA at those recognition sites Restriction endonucleases

47. Enzymes recognize specific 4-8 bp sequences EcoRI5’…GAATTC…3’ 3’…CTTAAG…5’ Recognition sites have symmetry Some enzymes cut in a staggered fashion Some enzymes cut in a direct fashion PvuII5’…CAGCTG…3’ 3’…GTCGAC…5’ Restriction Enzyme Recognition Site

48. Gel Electrophoresis

49. (At the negative pole) (Negative at the end with the wells containing the DNA and positive at the other end)

53. Southern Blotting- Makes a permanent record of the DNA pattern. Nitrocellulose paper often has a chemical on it that denatures the DNA

55. DNA Fingerprinting

56. , semen

60. DNA Fingerprinting Determination of an individual’s unique collection of DNA restriction fragments

61. Steps in Making a DNA Fingerprint 1. Specimen collection CSI for wildlife 2. DNA extraction 3. PCR if necessary 4. Cut DNA with Restriction Enzymes at restriction sites 5. Gel Electrophoresis 6. Southern Blot 7. Add Probe (radioactive or fluorescent) 8. X-Ray and develop or look at under UV light

62. Mitochondrial DNA (mtDNA) A. Mitochondria- sites of cellular respiration in the cell. 1. A single mitochondrion contains several loops of DNA. 2. mtDNA is inherited from only the mother since it is in the cytoplasm of the egg cell. 3. There are hundreds to thousands of mitochondria in a cell, but only one nucleus. 4.In situations where nuclear DNA is degraded, like in charred bodies, or is in small quantity like a hair shaft, mtDNA can be analyzed. 5. mtDNA analysis is more sensitive than nuclear DNA profiling but it is also more time consuming and expensive. 6. Another problem is that all maternally related people have the same mtDNA. 7. In cases involving a missing or long deceased, an mtDNA reference sample could be obtained from any maternally related relative. 8. Two variable regions exist- HV1 and HV2. When these areas are sequenced and analyzed, maternal lineage can be determined.

64. The Combined DNA Index Sequence (CODIS) A. Use in Forensic Science 1. All 50 states have mandated the collection of DNA from convicted offenders of particular crimes and the establishment of DNA data bases for law enforcement purposes. 2. The CODIS is a computer software program developed by the FBI that maintains local, state and national databases of DNA profiles of convicted offenders, unsolved crime scene evidence, and profiles of missing persons. 3. CODIS enable law officials to electronically compare DNA profiles. Thousands of matches have linked serial crimes to each other and have solved crimes by allowing investigators to match crime scene evidence to known convicted offenders. 4. It has also allowed for the exoneration of innocent people convicted of crimes they did not commit.

65. The Collection and Preservation of Biological Evidence for DNA Analysis A. Low copy number 1. About 3- 36 cells are needed for the most sensitive type of DNA profiling – STR. B. Crime Scene Procedures 1. After the usual initial crime scene analysis has been done (photographs, sketches, notes, blood spatter analysis) then collection of biological material can occur. 2. The evidence collector must handle all body fluids and biologically stained materials with a minimum amount of personal contact. 3. All body fluids must be considered to be infectious, so latex gloves must be worn. These gloves also serve to reduce the possibility of contamination of the evidence.

66. The Collection and Preservation of Biological Evidence for DNA Analysis 4. All clothing both from the victim and the suspect must be bagged, labeled and sent to the lab for analysis. 5. Efforts must be made to search for and collect less obvious evidence such as towels, handkerchiefs, or rags that may have been used and then hidden. 6. Floor cracks and other crevices must be searched for blood evidence. 7. Each stained article must be packaged separately in a paper bag or in a well ventilated box. 8. If this is not possible, dried blood should be removed with the aid of a sterile swab, lightly moistened with sterile distilled water. A portion of the unstained surface material near the stain must also be swabbed to serve as the substrate control.

67. The Collection and Preservation of Biological Evidence for DNA Analysis 9. All swabs must be dried before being packaged in a swab box. 10. All packaged biological material must be stored in a cool location until delivery to the lab. 11. Blood mixed with soil, however, should be immediately frozen due in a clean, sterile container due the microbes that would quickly degrade the DNA in the blood. 12. Blood from all victims and suspect (about 7 cc of whole blood) should be drawn by medical personnel. The blood should be preserved with EDTA. This chemical preserves the blood as well as inhibiting the action of enzymes in the blood that would act to degrade the DNA. The tubes must be refrigerated and sent to the lab.

68. The Collection and Preservation of Biological Evidence for DNA Analysis 13.A buccal swab is often taken by swabbing the inside of the cheek. This leaves buccal cells on the swab that can be tested for DNA. 14. Toothbrushes, hairbrushes or combs are also used to supply DNA. 15. Contamination of samples with foreign DNA from an investigator occurs by sneezing or coughing on the sample, or by packing the samples incorrectly. STR analysis shows such contamination because in this type of test only two bands signifying 2 alleles should be present. If more than 2 bands are present then contamination from an outside source occurred.

69. The Collection and Preservation of Biological Evidence for DNA Analysis 16. Other simple steps to avoid contamination include: Change gloves before handling a new piece of evidence. Collect substrate controls. Use clean forceps to pick up small items such as cigarette butts or stamps. Package each item in its own well ventilated container.