Download presentation
Presentation is loading. Please wait.
Published byBrianne Wilkinson Modified over 8 years ago
1
1 Probability Review E: set of equally likely outcomes A: an event E A Conditional Probability (Probability of A given B) Independent Events: Combined Probability Mutually Exclusive Events: A B A and B E
2
2 Probability Example Pets in a Pet Store blacktawny kitten517 puppy1023 P(black pet) P(dog) P(black dog) P(dog|black pet) P(black pet | dog) P(dog or black) P(black pet) = 15/55 = 3/11 P(puppy) = 33/55 = 3/5 P(black puppy) = 10/55 = 2/11 P(puppy|black pet) = 10/15 = 2/3 P(black pet | puppy) = 10/33 P(puppy or black) = (5+10+23)/55 =38/55 blacktawnytotal kitten51722 puppy102333 total154055
3
3 DNA Sequence Bases (nucleotides) A: adenine G: guanine C: cytosine T: thymine Purines adenine and guanine Pyrimidines cytosine and thymine
4
4 Mutations to DNA Sequences Base substitutions S 0 : GCCATCTGAA S 1 : GCTATTTGGA S 2 : GCTATGTGAA (a) transition: pur to pur or pyr to pyr Eg A changed to G (b) transversion: pur to pyr or pyr to pur Eg T changed to G Deletions S 0 : GCCATCTGAA S 1 : GCATCTGAA Insertions S 0 : GCCATCTGAA S 1 : GCCGATCTGAA Reversals S 0 : GCCATCTGAA S 1 : GCGTCTACAA
5
5 Probability of a base at a site of a sequence S 0 : GCCATCTGAAGTACTTGGACCATGCTGTTCAGAGGGTCGTX Best estimate of the probability of each base at site X P(A) P(G) P(C) P(T) Best estimate of the probability of each base at site X P(A) = 8/40 P(G) = 12/40 P(C) = 9/40 P(T) = 11/40 S 1 : ACCACCTGAAGCACTAGGGCGATGCCGTTTAGAGAGTTGTX n(A)=10 n(G)=11 n(C)=9 n(T)=10 Estimate of the probability of each base at site X P(A) P(G) P(C) P(T) Estimate of the probability of each base at site X (based on S 1 ) P(A) = 10/40 P(G) = 11/40 P(C) = 9/40 P(T) = 10/40 n(A)=8 n(G)=12 n(C)=9 n(T)=11 n(E)=40
6
6 Probability of a base at a site in aligned sequences S 0 : GCCATCTGAAGTACTTGGACCATGCTGTTCAGAGGGTCGTX S 1 : ACCACCTGAAGCACTAGGGCGATGCCGTTTAGAGAGTTGTX Best estimate of the probability of a base in one sequence given a base in another P(A 1 |A 0 ) P(A 1 |G 0 ) S 0 : GCCATCTGAAGTACTTGGACCATGCTGTTCAGAGGGTCGTX S 1 : ACCACCTGAAGCACTAGGGCGATGCCGTTTAGAGAGTTGTX Best estimate of the probability of a base in one sequence given a base in another P(A 1 |A 0 ) = 7/8 P(A 1 |G 0 ) Best estimate of the probability of a base in one sequence given a base in another P(A 1 |A 0 ) = 7/8 P(A 1 |G 0 ) = 2/12 S 0 : GCCATCTGAAGTACTTGGACCATGCTGTTCAGAGGGTCGTX S 1 : ACCACCTGAAGCACTAGGGCGATGCCGTTTAGAGAGTTGTX Table comparing bases at site X in aligned sequences S 0 and S 1 S 1 \ S 0 AGCT A72 G C T Total812 S 1 \ S 0 AGCTTotal A720110 G1 1012 C00639 T00279 Total81291140
7
7 Conditional Probability Table comparing bases at site X in aligned sequences S 0 and S 1 S 1 \ S 0 AGCTTotal A720110 G1 1012 C00639 T00279 Total81291140 Estimate of the conditional probability of a base at a site in sequence S 1 given a particular base at that site in sequence S 0 S 1 \ S 0 AGCT A7/82/1201/11 G1/810/121/90 C006/93/11 T002/97/11 Total1111
8
8 Conditional Probability Table of conditional probability of a base at a site in sequence S 1 given a particular base at that site in sequence S 0 S 1 \ S 0 AGCT A P(A 1 |A 0 )P(A 1 |G 0 )P(A 1 |C 0 )P(A 1 |T 0 ) G P(G 1 |A 0 )P(G 1 |G 0 )P(G 1 |C 0 )P(G 1 |T 0 ) C P(C 1 |A 0 )P(C 1 |G 0 )P(C 1 |C 0 )P(C 1 |T 0 ) T P(T 1 |A 0 )P(T 1 |G 0 )P(T 1 |C 0 )P(T 1 |T 0 ) Total1111 Objective: Create a model for the conditional probabilities in the above table and use the table to predict the probabilities of a particular base at a site in the future. For example, P(A 1 )
9
9 Building a model to predict how sequences change The probability of a base at a site in the future can be written as a matrix product. For example: The matrix M is called a transition matrix. Entries are probabilities. Columns sum to one. This is an example of a Markov Model.
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.