1. Evaluating the interaction of cell fate determinants: Does the Prospero transcription factor regulate notch? Emily Merfeld December 15, 2015

2. Outline 1.Background: Prospero and Notch signaling 1.Methods: Data and High-Level Coding Steps 1.Results 1.Implications & Areas for Further Study

3. Outline 1.Background: Prospero and Notch signaling 1.Methods: Data and High-Level Coding Steps 1.Results 1.Implications & Areas for Further Study

4. Background I: Cell fate Homem and Knoblich, 2012

5. Background II: Prospero Mutation of prospero → altered gene expression in specific cell types, altered cell type ratio 1 Prospero regulation of cell fate through several mechanisms: asymmetric localization of Prospero during division of neural stem cells 2 regulation of stem cell self-renewal vs. cell proliferation 3 1 Doe et al., 1991 2 Spana and Doe, 1995; 3 Choksi et al., 2006

6. Background III: Notch Mutation of notch → altered cell type ratio, altered growth & morphology Specific Notch pathway receptor and ligand expression → cell fate determination 1,2 1 Artavanis-Tsakonas et al.,, 1995; 2 Haines and Irvine, 2003 Haines and Irvine, 2003

7. Background IV: Prospero / Notch Interaction Prospero and Notch act together in cell fate determination in the Drosophila eye (1 photoreceptor neuron : 4 epithelial cells) 1 Prospero is regulated by Notch in cell fate determination in sensory organs 2 Notch signaling, and cell fate determination in general, rely on feedback regulation 3 … → Does the Pros transcription factor bind to the notch promoter region as one form of such regulation? 1 Charlton-Perkins et al., 2011; 2 Reddy and Rodrigues, 1999; 3 Artavanis-Tsakonas et al., 1999

8. Outline 1.Background: Prospero and Notch signaling 1.Methods: Data and High-Level Coding Steps 1.Results 1.Implications & Areas for Further Study

9. Methods I: Data notch promoter region: 1000 nucleotides upstream of the promoter, found through the UCSC Drosophila genome browser

10. Methods I: Data attcctttgagccatagtccacccgaggctttgagttctcagcaatcaggcgaatgtttcgacgcttttcgatgagaacg tttcttcgttcgcctatcgataaccagttatcgatgatggtgagtcatgactcatgactggccacgagccaagtggggg aggagagaccgaaatagtcgcccacgccgaagtatctgaagtagctgccacaaggggcaaactcgtttgtcagct aagaaaaacccctttgccgactcgaccggcccagcatcattcatcagtttttgactgcaacttttacatcgcagcccat tcccagtgcatttcattccattccaacgttccgggcgctttacaaatttaaagatcgtggccccatcaccgccgcctttctt ctgtttcttctgcagcttccactcttcttcggcttccttggccgcttgtgttgcatgacctccttagggcgtaactgtgcttaag catccaatccgccccgcagatcattggttaaagaattggtcggtgatgcgagtggatggaccaagaagacgggga aatgatagcctctggaattggcgcaattttcgccgagatttgctcacttgaataagcttttctgatgtttaaccgcctgggc atgaaactgttcaaaaatgaatggatgaagaatgctgggtaccaaaaaaaaaaaagcagaggaattcccctatat aatcgtataatcgaagttacgataggttacccacggaatttcgagatgattcatttagttctgtttcgtttttttattttatttttttt attttttttttttgagctagtctaattgtttatgcttacattttattgggttttaatttttcttcaaagggccgcttcaatctttttcctcttt gtgtttgtcttagattatttttaacgttttccttgttactttttcggtgccctcaacttgttttcccagcgaacaattttagtgagttg ccgcccgctgctgtgc notch promoter region:

11. Methods I: Data Table 1, Hassan et al., 1997 Pros transcription factor binding site: ‘C-A/t-c/t-N-N-C-T/c’

12. Methods II: High-level steps 1.Enumerate all possible binding sites from the consensus 1.Determine if any of these binding sites appear in the region upstream of notch

13. Methods II: Trickiest Problem Problem: enumerate all binding motifs from C-A/T-C/T-N-N-C-T/C Toy example: enumerate all binding motifs from A/T-C/T Input: bindingSite = ‘A/TC/T’ Output: bindingSiteList = [‘AC’, ‘AT’, ‘TC’, ‘TT’]

14. Methods II: Trickiest Problem Pseudocode generate blank bindingSiteList to hold all permutations of bindingSite for each element of bindingSite: if the element is a slash: add the letter before the slash to a permutation in bindingSiteList then add the letter after the slash to the next permutation otherwise add the element itself to BSL This method fills by column. Thus we have… A C T A C T Repeats! BSL= bindingSiteList = [‘AC’, ‘TT’, ‘AC’,‘TT’]

15. Methods II: Trickiest Problem New approach: build a “tree” bindingSiteList = [‘AC’, ‘AT’, ‘TC’, ‘TT’]

16. Methods II: Trickiest Problem “Tree” Method for ‘C-A/T-N’ bindingSiteList = [‘CAA’, ‘CAC’, ‘CAT, ‘CAG’, CTA, CTC, CTT, CTG]

17. bindingSiteList = ['cacaact', 'cacaacc', 'cacatct', 'cacatcc', 'cacacct', 'cacaccc', 'cacagct', 'cacagcc', 'cactact', 'cactacc', 'cacttct', 'cacttcc', 'cactcct', 'cactccc', 'cactgct', 'cactgcc', 'caccact', 'caccacc', 'cacctct', 'cacctcc', 'cacccct', 'caccccc', 'caccgct', 'caccgcc', 'cacgact', 'cacgacc', 'cacgtct', 'cacgtcc', 'cacgcct', 'cacgccc', 'cacggct', 'cacggcc', 'cataact', 'cataacc', 'catatct', 'catatcc', 'catacct', 'cataccc', 'catagct', 'catagcc', 'cattact', 'cattacc', 'catttct', 'catttcc', 'cattcct', 'cattccc', 'cattgct', 'cattgcc', 'catcact', 'catcacc', 'catctct', 'catctcc', 'catccct', 'catcccc', 'catcgct', 'catcgcc', 'catgact', 'catgacc', 'catgtct', 'catgtcc', 'catgcct', 'catgccc', 'catggct', 'catggcc', 'ctcaact', 'ctcaacc', 'ctcatct', 'ctcatcc', 'ctcacct', 'ctcaccc', 'ctcagct', 'ctcagcc', 'ctctact', 'ctctacc', 'ctcttct', 'ctcttcc', 'ctctcct', 'ctctccc', 'ctctgct', 'ctctgcc', 'ctccact', 'ctccacc', 'ctcctct', 'ctcctcc', 'ctcccct', 'ctccccc', 'ctccgct', 'ctccgcc', 'ctcgact', 'ctcgacc', 'ctcgtct', 'ctcgtcc', 'ctcgcct', 'ctcgccc', 'ctcggct', 'ctcggcc', 'cttaact', 'cttaacc', 'cttatct', 'cttatcc', 'cttacct', 'cttaccc', 'cttagct', 'cttagcc', 'ctttact', 'ctttacc', 'cttttct', 'cttttcc', 'ctttcct', 'ctttccc', 'ctttgct', 'ctttgcc', 'cttcact', 'cttcacc', 'cttctct', 'cttctcc', 'cttccct', 'cttcccc', 'cttcgct', 'cttcgcc', 'cttgact', 'cttgacc', 'cttgtct', 'cttgtcc', 'cttgcct', 'cttgccc', 'cttggct', 'cttggcc']

18. promoterRegion = ‘attcctttgagccatagtccacccgaggctttgagttctcagcaa tcaggcgaatgtttcgacgcttttcgatgagaacgtttcttcgttcg cctatcgataaccagttatcgatgatggtgagtcatgactcatga ctggccacgagccaagtgggggaggagagaccgaaatagt cgcccacgccgaagtatctgaagtagctgccacaaggggca aactcgtttgtcagctaagaaaaacccctttgccgactcgaccg gcccagcatcattcatcagtttttgactgcaacttttacatcgcag cccattcccagtgcatttcattccattccaacgttccgggcgcttta caaatttaaagatcgtggccccatcaccgccgcctttcttctgtttc ttctgcagcttccactcttcttcggcttccttggccgcttgtgttgcat gacctccttagggcgtaactgtgcttaagcatccaatccgcccc gcagatcattggttaaagaattggtcggtgatgcgagtggatgg accaagaagacggggaaatgatagcctctggaattggcgca attttcgccgagatttgctcacttgaataagcttttctgatgtttaac cgcctgggcatgaaactgttcaaaaatgaatggatgaagaatg ctgggtaccaaaaaaaaaaaagcagaggaattcccctatata atcgtataatcgaagttacgataggttacccacggaatttcgag atgattcatttagttctgtttcgtttttttattttattttttttattttttttttttga gctagtctaattgtttatgcttacattttattgggttttaatttttcttcaa agggccgcttcaatctttttcctctttgtgtttgtcttagattatttttaa cgttttccttgttactttttcggtgccctcaacttgttttcccagcgaa caattttagtgagttgccgcccgctgctgtgc’

19. bindingSiteList = ['cacaact', 'cacaacc', 'cacatct', 'cacatcc', 'cacacct', 'cacaccc', 'cacagct', 'cacagcc', 'cactact', 'cactacc', 'cacttct', 'cacttcc', 'cactcct', 'cactccc', 'cactgct', 'cactgcc', 'caccact', 'caccacc', 'cacctct', 'cacctcc', 'cacccct', 'caccccc', 'caccgct', 'caccgcc', 'cacgact', 'cacgacc', 'cacgtct', 'cacgtcc', 'cacgcct', 'cacgccc', 'cacggct', 'cacggcc', 'cataact', 'cataacc', 'catatct', 'catatcc', 'catacct', 'cataccc', 'catagct', 'catagcc', 'cattact', 'cattacc', 'catttct', 'catttcc', 'cattcct', 'cattccc', 'cattgct', 'cattgcc', 'catcact', 'catcacc', 'catctct', 'catctcc', 'catccct', 'catcccc', 'catcgct', 'catcgcc', 'catgact', 'catgacc', 'catgtct', 'catgtcc', 'catgcct', 'catgccc', 'catggct', 'catggcc', 'ctcaact', 'ctcaacc', 'ctcatct', 'ctcatcc', 'ctcacct', 'ctcaccc', 'ctcagct', 'ctcagcc', 'ctctact', 'ctctacc', 'ctcttct', 'ctcttcc', 'ctctcct', 'ctctccc', 'ctctgct', 'ctctgcc', 'ctccact', 'ctccacc', 'ctcctct', 'ctcctcc', 'ctcccct', 'ctccccc', 'ctccgct', 'ctccgcc', 'ctcgact', 'ctcgacc', 'ctcgtct', 'ctcgtcc', 'ctcgcct', 'ctcgccc', 'ctcggct', 'ctcggcc', 'cttaact', 'cttaacc', 'cttatct', 'cttatcc', 'cttacct', 'cttaccc', 'cttagct', 'cttagcc', 'ctttact', 'ctttacc', 'cttttct', 'cttttcc', 'ctttcct', 'ctttccc', 'ctttgct', 'ctttgcc', 'cttcact', 'cttcacc', 'cttctct', 'cttctcc', 'cttccct', 'cttcccc', 'cttcgct', 'cttcgcc', 'cttgact', 'cttgacc', 'cttgtct', 'cttgtcc', 'cttgcct', 'cttgccc', 'cttggct', 'cttggcc'] promoterRegion = ‘attcctttgagccatagtccacccgaggctttgagttctcagcaa tcaggcgaatgtttcgacgcttttcgatgagaacgtttcttcgttcg cctatcgataaccagttatcgatgatggtgagtcatgactcatga ctggccacgagccaagtgggggaggagagaccgaaatagt cgcccacgccgaagtatctgaagtagctgccacaaggggca aactcgtttgtcagctaagaaaaacccctttgccgactcgaccg gcccagcatcattcatcagtttttgactgcaacttttacatcgcag cccattcccagtgcatttcattccattccaacgttccgggcgcttta caaatttaaagatcgtggccccatcaccgccgcctttcttctgtttc ttctgcagcttccactcttcttcggcttccttggccgcttgtgttgcat gacctccttagggcgtaactgtgcttaagcatccaatccgcccc gcagatcattggttaaagaattggtcggtgatgcgagtggatgg accaagaagacggggaaatgatagcctctggaattggcgca attttcgccgagatttgctcacttgaataagcttttctgatgtttaac cgcctgggcatgaaactgttcaaaaatgaatggatgaagaatg ctgggtaccaaaaaaaaaaaagcagaggaattcccctatata atcgtataatcgaagttacgataggttacccacggaatttcgag atgattcatttagttctgtttcgtttttttattttattttttttattttttttttttga gctagtctaattgtttatgcttacattttattgggttttaatttttcttcaa agggccgcttcaatctttttcctctttgtgtttgtcttagattatttttaa cgttttccttgttactttttcggtgccctcaacttgttttcccagcgaa caattttagtgagttgccgcccgctgctgtgc’

20. Outline 1.Background: Prospero and Notch signaling 1.Methods: Data and High-Level Coding Steps 1.Results 1.Implications & Areas for Further Study

21. Results: Pros binding sites in notch promoter region attcctttgagccatagtccacccgaggctttgagttctcagcaatcaggcgaatgtttcgacgcttttcgatga gaacgtttcttcgttcgcctatcgataaccagttatcgatgatggtgagtcatgactcatgactggccacgag ccaagtgggggaggagagaccgaaatagtcgcccacgccgaagtatctgaagtagctgccacaaggg gcaaactcgtttgtcagctaagaaaaacccctttgccgactcgaccggcccagcatcattcatcagtttttga ctgcaacttttacatcgcagcccattcccagtgcatttcattccattccaacgttccgggcgctttacaaatttaa agatcgtggccccatcaccgccgcctttcttctgtttcttctgcagcttccactcttcttcggcttccttggccgctt gtgttgcatgacctccttagggcgtaactgtgcttaagcatccaatccgccccgcagatcattggttaaagaa ttggtcggtgatgcgagtggatggaccaagaagacggggaaatgatagcctctggaattggcgcaattttc gccgagatttgctcacttgaataagcttttctgatgtttaaccgcctgggcatgaaactgttcaaaaatgaatg gatgaagaatgctgggtaccaaaaaaaaaaaagcagaggaattcccctatataatcgtataatcgaagtt acgataggttacccacggaatttcgagatgattcatttagttctgtttcgtttttttattttattttttttattttttttttttgag ctagtctaattgtttatgcttacattttattgggttttaatttttcttcaaagggccgcttcaatctttttcctctttgtgtttg tcttagattatttttaacgttttccttgttactttttcggtgccctcaacttgttttcccagcgaacaattttagtgagttg ccgcccgctgctgtgc bindingSites = ['catgact', 'ctttgcc', 'ctcgacc', 'cattccc', 'catcacc', 'caccgcc', 'ctcttct', 'cttggcc', 'catgacc', 'cttttct', 'ctcaact']

22. Outline 1.Background: Prospero and Notch signaling 1.Methods: Data and High-Level Coding Steps 1.Results 1.Implications & Areas for Further Study

23. Implications ●Pros transcription factor may regulate Notch expression in cells → novel mechanism of cell differentiation regulation ●Relevance to cancer: ○Misregulation of cell differentiation has been linked to cancer development and tumorous growth 1 ○Preestablished role of Notch 2 and Prospero 3 signaling in cancer → interactive role in cancer? 1 Al-Hajj et al., 2003; 2 Arnold et al., 2015; 3 Lu et al., 2012

24. Artavania-Taakonas et al., 1999 Areas for Further Study Computational problems ●Is this statistically significant? ●Does the Pros transcription factor regulate other elements of the Notch signaling pathway? Empirical problems ●in vitro: are these sequences sufficient for Pros binding? ●in vivo: do prospero-KDs show altered notch RNA expression?

25. References Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., & Clarke, M. F. (2003). Prospective identification of tumorigenic breast cancer cells. Proceedings of the National Academy of Sciences of the United States of America, 100(7), 3983–8. http://doi.org/10.1073/pnas.0530291100 Arnold, K. M., Opdenaker, L. M., Flynn, D., & Sims-mourtada, J. (2015). Cancer Growth and Metastasis of Treatment Resistance in Breast Cancer. Cancer Growht and Metastasis, 1–13. http://doi.org/10.4137/CGM.S11286.RECEIVED Artavanis-tsakonas, S., Rand, M. D., & Lake, R. J. (1999). Notch Signaling: Cell Fate Control and Signal Integration in Development. Signal Transduction, 284(April), 770–776. http://doi.org/10.1126/science.284.5415.770 Charlton-Perkins, M., Whitaker, S. L., Fei, Y., Xie, B., Li-Kroeger, D., Gebelein, B., & Cook, T. (2011). Prospero and Pax2 combinatorially control neural cell fate decisions by modulating Ras- and Notch-dependent signaling. Neural Development, 6(1), 20. http://doi.org/10.1186/1749-8104-6-20 Choksi, S. P., Southall, T. D., Bossing, T., Edoff, K., de Wit, E., Fischer, B. E., … Brand, A. H. (2006). Prospero acts as a binary switch between self-renewal and differentiation in Drosophila neural stem cells. Developmental Cell, 11(6), 775–89. http://doi.org/10.1016/j.devcel.2006.09.015 Doe, C., Chu-LaGraff, Q., Wright, D., & Scott, M. (1991). The prospero gene specifies cell fates in the Drosophila central nervous system. Cell. Retrieved from http://www.sciencedirect.com/science/article/pii/0092867491904639 Haines, N., & Irvine, K. D. (2003). Glycosylation regulates Notch signalling. Nature Reviews. Molecular Cell Biology, 4(10), 786– 797. http://doi.org/10.1038/nrm1228 Hassan, B., Li, L., Bremer, K. a., Chang, W., Pinsonneault, J., & Vaessin, H. (1997). Prospero is a panneural transcription factor that modulates homeodomain protein activity. Proceedings of the National Academy of Sciences, 94(20), 10991–10996. http://doi.org/10.1073/pnas.94.20.10991 Lu, M.-H., Huang, C.-C., Pan, M.-R., Chen, H.-H., & Hung, W.-C. (2012). Prospero Homeobox 1 Promotes Epithelial- Mesenchymal Transition in Colon Cancer Cells by Inhibiting E-cadherin via miR-9. Clinical Cancer Research, 18(23), 6416– 6425. http://doi.org/10.1158/1078-0432.CCR-12-0832 Reddy, G. V, & Rodrigues, V. (1999). Sibling cell fate in the Drosophila adult external sense organ lineage is specified by prospero function, which is regulated by Numb and Notch. Development, 126(10), 2083–92. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10207134 Spana, E. P., & Doe, C. Q. (1995). The prospero transcription factor is asymmetrically localized to the cell cortex during neuroblast mitosis in Drosophila. Development (Cambridge, England), 121, 3187–3195. http://doi.org/10.1016/0168- 9525(96)81394-1